Files
phpredis/redis.stub.php
Pavlo Yatsukhnenko 7d3b2e4d6d Add hGetWithMeta method
2025-10-06 16:22:59 -07:00

5050 lines
193 KiB
PHP
Raw Permalink Blame History

This file contains invisible Unicode characters
This file contains invisible Unicode characters that are indistinguishable to humans but may be processed differently by a computer. If you think that this is intentional, you can safely ignore this warning. Use the Escape button to reveal them.
<?php
/**
* @generate-function-entries
* @generate-legacy-arginfo
* @generate-class-entries
*/
class Redis {
/**
*
* @var int
* @cvalue REDIS_NOT_FOUND
*
*/
public const REDIS_NOT_FOUND = UNKNOWN;
/**
*
* @var int
* @cvalue REDIS_STRING
*
*/
public const REDIS_STRING = UNKNOWN;
/**
*
* @var int
* @cvalue REDIS_SET
*
*/
public const REDIS_SET = UNKNOWN;
/**
*
* @var int
* @cvalue REDIS_LIST
*
*/
public const REDIS_LIST = UNKNOWN;
/**
*
* @var int
* @cvalue REDIS_ZSET
*
*/
public const REDIS_ZSET = UNKNOWN;
/**
*
* @var int
* @cvalue REDIS_HASH
*
*/
public const REDIS_HASH = UNKNOWN;
/**
*
* @var int
* @cvalue REDIS_STREAM
*
*/
public const REDIS_STREAM = UNKNOWN;
/**
*
* @var int
* @cvalue REDIS_VECTORSET
*
*/
public const REDIS_VECTORSET = UNKNOWN;
/**
*
* @var int
* @cvalue ATOMIC
*
*/
public const ATOMIC = UNKNOWN;
/**
*
* @var int
* @cvalue MULTI
*
*/
public const MULTI = UNKNOWN;
/**
*
* @var int
* @cvalue PIPELINE
*
*/
public const PIPELINE = UNKNOWN;
/**
*
* @var int
* @cvalue REDIS_OPT_SERIALIZER
*
*/
public const OPT_SERIALIZER = UNKNOWN;
/**
*
* @var int
* @cvalue REDIS_OPT_PREFIX
*
*/
public const OPT_PREFIX = UNKNOWN;
/**
*
* @var int
* @cvalue REDIS_OPT_READ_TIMEOUT
*
*/
public const OPT_READ_TIMEOUT = UNKNOWN;
/**
*
* @var int
* @cvalue REDIS_OPT_TCP_KEEPALIVE
*
*/
public const OPT_TCP_KEEPALIVE = UNKNOWN;
/**
*
* @var int
* @cvalue REDIS_OPT_COMPRESSION
*
*/
public const OPT_COMPRESSION = UNKNOWN;
/**
*
* @var int
* @cvalue REDIS_OPT_REPLY_LITERAL
*
*/
public const OPT_REPLY_LITERAL = UNKNOWN;
/**
*
* @var int
* @cvalue REDIS_OPT_COMPRESSION_LEVEL
*
*/
public const OPT_COMPRESSION_LEVEL = UNKNOWN;
/**
*
* @var int
* @cvalue REDIS_OPT_NULL_MBULK_AS_NULL
*
*/
public const OPT_NULL_MULTIBULK_AS_NULL = UNKNOWN;
/**
* @var int
* @cvalue REDIS_OPT_PACK_IGNORE_NUMBERS
*
* When enabled, this option tells PhpRedis to ignore purely numeric values
* when packing and unpacking data. This does not include numeric strings.
* If you want numeric strings to be ignored, typecast them to an int or float.
*
* The primary purpose of this option is to make it more ergonomic when
* setting keys that will later be incremented or decremented.
*
* Note: This option incurs a small performance penalty when reading data
* because we have to see if the data is a string representation of an int
* or float.
*
* @example
* $redis->setOption(Redis::OPT_SERIALIZER, Redis::SERIALIZER_IGBINARY);
* $redis->setOption(Redis::OPT_PACK_IGNORE_NUMBERS, true);
*
* $redis->set('answer', 32);
*
* var_dump($redis->incrBy('answer', 10)); // int(42)
* var_dump($redis->get('answer')); // int(42)
*/
public const OPT_PACK_IGNORE_NUMBERS = UNKNOWN;
/**
*
* @var int
* @cvalue REDIS_SERIALIZER_NONE
*
*/
public const SERIALIZER_NONE = UNKNOWN;
/**
*
* @var int
* @cvalue REDIS_SERIALIZER_PHP
*
*/
public const SERIALIZER_PHP = UNKNOWN;
#ifdef HAVE_REDIS_IGBINARY
/**
*
* @var int
* @cvalue REDIS_SERIALIZER_IGBINARY
*
*/
public const SERIALIZER_IGBINARY = UNKNOWN;
#endif
#ifdef HAVE_REDIS_MSGPACK
/**
*
* @var int
* @cvalue REDIS_SERIALIZER_MSGPACK
*
*/
public const SERIALIZER_MSGPACK = UNKNOWN;
#endif
/**
*
* @var int
* @cvalue REDIS_SERIALIZER_JSON
*
*/
public const SERIALIZER_JSON = UNKNOWN;
/**
*
* @var int
* @cvalue REDIS_COMPRESSION_NONE
*
*/
public const COMPRESSION_NONE = UNKNOWN;
#ifdef HAVE_REDIS_LZF
/**
*
* @var int
* @cvalue REDIS_COMPRESSION_LZF
*
*/
public const COMPRESSION_LZF = UNKNOWN;
#endif
#ifdef HAVE_REDIS_ZSTD
/**
*
* @var int
* @cvalue REDIS_COMPRESSION_ZSTD
*
*/
public const COMPRESSION_ZSTD = UNKNOWN;
#ifdef ZSTD_CLEVEL_DEFAULT
/**
*
* @var int
* @cvalue ZSTD_CLEVEL_DEFAULT
*
*/
public const COMPRESSION_ZSTD_DEFAULT = UNKNOWN;
#else
/**
*
* @var int
*
*/
public const COMPRESSION_ZSTD_DEFAULT = 3;
#endif
#if ZSTD_VERSION_NUMBER >= 10400
/**
*
* @var int
* @cvalue ZSTD_minCLevel()
*
*/
public const COMPRESSION_ZSTD_MIN = UNKNOWN;
#else
/**
*
* @var int
*
*/
public const COMPRESSION_ZSTD_MIN = 1;
#endif
/**
* @var int
* @cvalue ZSTD_maxCLevel()
*/
public const COMPRESSION_ZSTD_MAX = UNKNOWN;
#endif
#ifdef HAVE_REDIS_LZ4
/**
*
* @var int
* @cvalue REDIS_COMPRESSION_LZ4
*
*/
public const COMPRESSION_LZ4 = UNKNOWN;
#endif
/**
*
* @var int
* @cvalue REDIS_OPT_SCAN
*
*/
public const OPT_SCAN = UNKNOWN;
/**
*
* @var int
* @cvalue REDIS_SCAN_RETRY
*
*/
public const SCAN_RETRY = UNKNOWN;
/**
*
* @var int
* @cvalue REDIS_SCAN_NORETRY
*
*/
public const SCAN_NORETRY = UNKNOWN;
/**
*
* @var int
* @cvalue REDIS_SCAN_PREFIX
*
*/
public const SCAN_PREFIX = UNKNOWN;
/**
*
* @var int
* @cvalue REDIS_SCAN_NOPREFIX
*
*/
public const SCAN_NOPREFIX = UNKNOWN;
/**
*
* @var string
*
*/
public const BEFORE = "before";
/**
*
* @var string
*
*/
public const AFTER = "after";
/**
*
* @var string
*
*/
public const LEFT = "left";
/**
*
* @var string
*
*/
public const RIGHT = "right";
/**
*
* @var int
* @cvalue REDIS_OPT_MAX_RETRIES
*
*/
public const OPT_MAX_RETRIES = UNKNOWN;
/**
*
* @var int
* @cvalue REDIS_OPT_BACKOFF_ALGORITHM
*
*/
public const OPT_BACKOFF_ALGORITHM = UNKNOWN;
/**
*
* @var int
* @cvalue REDIS_BACKOFF_ALGORITHM_DEFAULT
*
*/
public const BACKOFF_ALGORITHM_DEFAULT = UNKNOWN;
/**
*
* @var int
* @cvalue REDIS_BACKOFF_ALGORITHM_CONSTANT
*
*/
public const BACKOFF_ALGORITHM_CONSTANT = UNKNOWN;
/**
*
* @var int
* @cvalue REDIS_BACKOFF_ALGORITHM_UNIFORM
*
*/
public const BACKOFF_ALGORITHM_UNIFORM = UNKNOWN;
/**
*
* @var int
* @cvalue REDIS_BACKOFF_ALGORITHM_EXPONENTIAL
*
*/
public const BACKOFF_ALGORITHM_EXPONENTIAL = UNKNOWN;
/**
*
* @var int
* @cvalue REDIS_BACKOFF_ALGORITHM_FULL_JITTER
*
*/
public const BACKOFF_ALGORITHM_FULL_JITTER = UNKNOWN;
/**
*
* @var int
* @cvalue REDIS_BACKOFF_ALGORITHM_EQUAL_JITTER
*
*/
public const BACKOFF_ALGORITHM_EQUAL_JITTER = UNKNOWN;
/**
*
* @var int
* @cvalue REDIS_BACKOFF_ALGORITHM_DECORRELATED_JITTER
*
*/
public const BACKOFF_ALGORITHM_DECORRELATED_JITTER = UNKNOWN;
/**
*
* @var int
* @cvalue REDIS_OPT_BACKOFF_BASE
*
*/
public const OPT_BACKOFF_BASE = UNKNOWN;
/**
*
* @var int
* @cvalue REDIS_OPT_BACKOFF_CAP
*
*/
public const OPT_BACKOFF_CAP = UNKNOWN;
/**
* Create a new Redis instance. If passed sufficient information in the
* options array it is also possible to connect to an instance at the same
* time.
*
* **NOTE**: Below is an example options array with various setting
*
* $options = [
* 'host' => 'localhost',
* 'port' => 6379,
* 'readTimeout' => 2.5,
* 'connectTimeout' => 2.5,
* 'persistent' => true,
*
* // Valid formats: NULL, ['user', 'pass'], 'pass', or ['pass']
* 'auth' => ['phpredis', 'phpredis'],
*
* // See PHP stream options for valid SSL configuration settings.
* 'ssl' => ['verify_peer' => false],
*
* // How quickly to retry a connection after we time out or it closes.
* // Note that this setting is overridden by 'backoff' strategies.
* 'retryInterval' => 100,
*
* // Which backoff algorithm to use. 'decorrelated jitter' is
* // likely the best one for most solution, but there are many
* // to choose from:
* // REDIS_BACKOFF_ALGORITHM_DEFAULT
* // REDIS_BACKOFF_ALGORITHM_CONSTANT
* // REDIS_BACKOFF_ALGORITHM_UNIFORM
* // REDIS_BACKOFF_ALGORITHM_EXPONENTIAL
* // REDIS_BACKOFF_ALGORITHM_FULL_JITTER
* // REDIS_BACKOFF_ALGORITHM_EQUAL_JITTER
* // REDIS_BACKOFF_ALGORITHM_DECORRELATED_JITTER
* // 'base', and 'cap' are in milliseconds and represent the first
* // delay redis will use when reconnecting, and the maximum delay
* // we will reach while retrying.
* 'backoff' => [
* 'algorithm' => Redis::BACKOFF_ALGORITHM_DECORRELATED_JITTER,
* 'base' => 500,
* 'cap' => 750,
* ]
* ];
*
* Note: If you do wish to connect via the constructor, only 'host' is
* strictly required, which will cause PhpRedis to connect to that
* host on Redis' default port (6379).
*
*
* @see Redis::connect()
* @see https://aws.amazon.com/blogs/architecture/exponential-backoff-and-jitter/
* @param array $options
*
* @return Redis
*/
public function __construct(?array $options = null);
public function __destruct();
/**
* Compress a value with the currently configured compressor as set with
* Redis::setOption().
*
* @see Redis::setOption()
*
* @param string $value The value to be compressed
* @return string The compressed result
*
*/
public function _compress(string $value): string;
/**
* Uncompress the provided argument that has been compressed with the
* currently configured compressor as set with Redis::setOption().
*
* @see Redis::setOption()
*
* @param string $value The compressed value to uncompress.
* @return string The uncompressed result.
*
*/
public function _uncompress(string $value): string;
/**
* Prefix the passed argument with the currently set key prefix as set
* with Redis::setOption().
*
* @param string $key The key/string to prefix
* @return string The prefixed string
*
*/
public function _prefix(string $key): string;
/**
* Serialize the provided value with the currently set serializer as set
* with Redis::setOption().
*
* @see Redis::setOption()
*
* @param mixed $value The value to serialize
* @return string The serialized result
*
*/
public function _serialize(mixed $value): string;
/**
* Unserialize the passed argument with the currently set serializer as set
* with Redis::setOption().
*
* @see Redis::setOption()
*
* @param string $value The value to unserialize
* @return mixed The unserialized result
*
*/
public function _unserialize(string $value): mixed;
/**
* Pack the provided value with the configured serializer and compressor
* as set with Redis::setOption().
*
* @param mixed $value The value to pack
* @return string The packed result having been serialized and
* compressed.
*/
public function _pack(mixed $value): string;
/**
* Unpack the provided value with the configured compressor and serializer
* as set with Redis::setOption().
*
* @param string $value The value which has been serialized and compressed.
* @return mixed The uncompressed and eserialized value.
*
*/
public function _unpack(string $value): mixed;
public function acl(string $subcmd, string ...$args): mixed;
/**
* Append data to a Redis STRING key.
*
* @param string $key The key in question
* @param mixed $value The data to append to the key.
*
* @return Redis|int|false The new string length of the key or false on failure.
*
* @see https://redis.io/commands/append
*
* @example
* $redis->set('foo', 'hello);
* $redis->append('foo', 'world');
*/
public function append(string $key, mixed $value): Redis|int|false;
/**
* Authenticate a Redis connection after its been established.
*
* $redis->auth('password');
* $redis->auth(['password']);
* $redis->auth(['username', 'password']);
*
* @see https://redis.io/commands/auth
*
* @param mixed $credentials A string password, or an array with one or two string elements.
* @return Redis|bool Whether the AUTH was successful.
*
*/
public function auth(#[\SensitiveParameter] mixed $credentials): Redis|bool;
/**
* Execute a save of the Redis database in the background.
*
* @see https://redis.io/commands/bgsave
*
* @return Redis|bool Whether the command was successful.
*/
public function bgSave(): Redis|bool;
/**
* Asynchronously rewrite Redis' append-only file
*
* @see https://redis.io/commands/bgrewriteaof
*
* @return Redis|bool Whether the command was successful.
*/
public function bgrewriteaof(): Redis|bool;
/**
* @see https://redis.io/commands/waitaof
*
* @return Redis|array
*/
public function waitaof(int $numlocal, int $numreplicas, int $timeout): Redis|array|false;
/**
* Count the number of set bits in a Redis string.
*
* @see https://redis.io/commands/bitcount/
*
* @param string $key The key in question (must be a string key)
* @param int $start The index where Redis should start counting. If omitted it
* defaults to zero, which means the start of the string.
* @param int $end The index where Redis should stop counting. If omitted it
* defaults to -1, meaning the very end of the string.
*
* @param bool $bybit Whether or not Redis should treat $start and $end as bit
* positions, rather than bytes.
*
* @return Redis|int|false The number of bits set in the requested range.
*
*/
public function bitcount(string $key, int $start = 0, int $end = -1, bool $bybit = false): Redis|int|false;
public function bitop(string $operation, string $deskey, string $srckey, string ...$other_keys): Redis|int|false;
/**
* Return the position of the first bit set to 0 or 1 in a string.
*
* @see https://redis.io/commands/bitpos/
*
* @param string $key The key to check (must be a string)
* @param bool $bit Whether to look for an unset (0) or set (1) bit.
* @param int $start Where in the string to start looking.
* @param int $end Where in the string to stop looking.
* @param bool $bybit If true, Redis will treat $start and $end as BIT values and not bytes, so if start
* was 0 and end was 2, Redis would only search the first two bits.
*
* @return Redis|int|false The position of the first set or unset bit.
**/
public function bitpos(string $key, bool $bit, int $start = 0, int $end = -1, bool $bybit = false): Redis|int|false;
/**
* Pop an element off the beginning of a Redis list or lists, potentially blocking up to a specified
* timeout. This method may be called in two distinct ways, of which examples are provided below.
*
* @see https://redis.io/commands/blpop/
*
* @param string|array $key_or_keys This can either be a string key or an array of one or more
* keys.
* @param string|float|int $timeout_or_key If the previous argument was a string key, this can either
* be an additional key, or the timeout you wish to send to
* the command.
*
* @return Redis|array|null|false Can return various things depending on command and data in Redis.
*
* @example
* $redis->blPop('list1', 'list2', 'list3', 1.5);
* $relay->blPop(['list1', 'list2', 'list3'], 1.5);
*/
public function blPop(string|array $key_or_keys, string|float|int $timeout_or_key, mixed ...$extra_args): Redis|array|null|false;
/**
* Pop an element off of the end of a Redis list or lists, potentially blocking up to a specified timeout.
* The calling convention is identical to Redis::blPop() so see that documentation for more details.
*
* @see https://redis.io/commands/brpop/
* @see Redis::blPop()
*
*/
public function brPop(string|array $key_or_keys, string|float|int $timeout_or_key, mixed ...$extra_args): Redis|array|null|false;
/**
* Pop an element from the end of a Redis list, pushing it to the beginning of another Redis list,
* optionally blocking up to a specified timeout.
*
* @see https://redis.io/commands/brpoplpush/
*
* @param string $src The source list
* @param string $dst The destination list
* @param int|float $timeout The number of seconds to wait. Note that you must be connected
* to Redis >= 6.0.0 to send a floating point timeout.
*
*/
public function brpoplpush(string $src, string $dst, int|float $timeout): Redis|string|false;
/**
* POP the maximum scoring element off of one or more sorted sets, blocking up to a specified
* timeout if no elements are available.
*
* Following are examples of the two main ways to call this method.
*
* **NOTE**: We recommend calling this function with an array and a timeout as the other strategy
* may be deprecated in future versions of PhpRedis
*
* @see https://redis.io/commands/bzpopmax
*
* @param string|array $key_or_keys Either a string key or an array of one or more keys.
* @param string|int $timeout_or_key If the previous argument was an array, this argument
* must be a timeout value. Otherwise it could also be
* another key.
* @param mixed $extra_args Can consist of additional keys, until the last argument
* which needs to be a timeout.
*
* @return Redis|array|false The popped elements.
*
* @example
* $redis->bzPopMax('key1', 'key2', 'key3', 1.5);
* $redis->bzPopMax(['key1', 'key2', 'key3'], 1.5);
*/
public function bzPopMax(string|array $key, string|int $timeout_or_key, mixed ...$extra_args): Redis|array|false;
/**
* POP the minimum scoring element off of one or more sorted sets, blocking up to a specified timeout
* if no elements are available
*
* This command is identical in semantics to bzPopMax so please see that method for more information.
*
* @see https://redis.io/commands/bzpopmin
* @see Redis::bzPopMax()
*
*/
public function bzPopMin(string|array $key, string|int $timeout_or_key, mixed ...$extra_args): Redis|array|false;
/**
* POP one or more elements from one or more sorted sets, blocking up to a specified amount of time
* when no elements are available.
*
* @param float $timeout How long to block if there are no element available
* @param array $keys The sorted sets to pop from
* @param string $from The string 'MIN' or 'MAX' (case insensitive) telling Redis whether you wish to
* pop the lowest or highest scoring members from the set(s).
* @param int $count Pop up to how many elements.
*
* @return Redis|array|null|false This function will return an array of popped elements, or false
* depending on whether any elements could be popped within the
* specified timeout.
*
* NOTE: If Redis::OPT_NULL_MULTIBULK_AS_NULL is set to true via Redis::setOption(), this method will
* instead return NULL when Redis doesn't pop any elements.
*/
public function bzmpop(float $timeout, array $keys, string $from, int $count = 1): Redis|array|null|false;
/**
* POP one or more of the highest or lowest scoring elements from one or more sorted sets.
*
* @see https://redis.io/commands/zmpop
*
* @param array $keys One or more sorted sets
* @param string $from The string 'MIN' or 'MAX' (case insensitive) telling Redis whether you want to
* pop the lowest or highest scoring elements.
* @param int $count Pop up to how many elements at once.
*
* @return Redis|array|null|false An array of popped elements or false if none could be popped.
*/
public function zmpop(array $keys, string $from, int $count = 1): Redis|array|null|false;
/**
* Pop one or more elements from one or more Redis LISTs, blocking up to a specified timeout when
* no elements are available.
*
* @see https://redis.io/commands/blmpop
*
* @param float $timeout The number of seconds Redis will block when no elements are available.
* @param array $keys One or more Redis LISTs to pop from.
* @param string $from The string 'LEFT' or 'RIGHT' (case insensitive), telling Redis whether
* to pop elements from the beginning or end of the LISTs.
* @param int $count Pop up to how many elements at once.
*
* @return Redis|array|null|false One or more elements popped from the list(s) or false if all LISTs
* were empty.
*/
public function blmpop(float $timeout, array $keys, string $from, int $count = 1): Redis|array|null|false;
/**
* Pop one or more elements off of one or more Redis LISTs.
*
* @see https://redis.io/commands/lmpop
*
* @param array $keys An array with one or more Redis LIST key names.
* @param string $from The string 'LEFT' or 'RIGHT' (case insensitive), telling Redis whether to pop\
* elements from the beginning or end of the LISTs.
* @param int $count The maximum number of elements to pop at once.
*
* @return Redis|array|null|false One or more elements popped from the LIST(s) or false if all the LISTs
* were empty.
*
*/
public function lmpop(array $keys, string $from, int $count = 1): Redis|array|null|false;
/**
* Reset any last error on the connection to NULL
*
* @see Redis::getLastError()
* @return bool This should always return true or throw an exception if we're not connected.
*
* @example
* $redis = new Redis(['host' => 'localhost']);
* $redis->set('string', 'this_is_a_string');
* $redis->smembers('string');
* var_dump($redis->getLastError());
* $redis->clearLastError();
* var_dump($redis->getLastError());
*/
public function clearLastError(): bool;
public function client(string $opt, mixed ...$args): mixed;
public function close(): bool;
public function command(?string $opt = null, mixed ...$args): mixed;
/**
* Execute the Redis CONFIG command in a variety of ways.
*
* What the command does in particular depends on the `$operation` qualifier.
* Operations that PhpRedis supports are: RESETSTAT, REWRITE, GET, and SET.
*
* @param string $operation The CONFIG operation to execute (e.g. GET, SET, REWRITE).
* @param array|string|null $key_or_settings One or more keys or values.
* @param string $value The value if this is a `CONFIG SET` operation.
* @see https://redis.io/commands/config
*
* @example
* $redis->config('GET', 'timeout');
* $redis->config('GET', ['timeout', 'databases']);
* $redis->config('SET', 'timeout', 30);
* $redis->config('SET', ['timeout' => 30, 'loglevel' => 'warning']);
*/
public function config(string $operation, array|string|null $key_or_settings = null, ?string $value = null): mixed;
public function connect(string $host, int $port = 6379, float $timeout = 0, ?string $persistent_id = null,
int $retry_interval = 0, float $read_timeout = 0, ?array $context = null): bool;
/**
* Make a copy of a key.
*
* $redis = new Redis(['host' => 'localhost']);
*
* @param string $src The key to copy
* @param string $dst The name of the new key created from the source key.
* @param array $options An array with modifiers on how COPY should operate.
* <code>
* $options = [
* 'REPLACE' => true|false # Whether to replace an existing key.
* 'DB' => int # Copy key to specific db.
* ];
* </code>
*
* @return Redis|bool True if the copy was completed and false if not.
*
* @see https://redis.io/commands/copy
*
* @example
* $redis->pipeline()
* ->select(1)
* ->del('newkey')
* ->select(0)
* ->del('newkey')
* ->mset(['source1' => 'value1', 'exists' => 'old_value'])
* ->exec();
*
* var_dump($redis->copy('source1', 'newkey'));
* var_dump($redis->copy('source1', 'newkey', ['db' => 1]));
* var_dump($redis->copy('source1', 'exists'));
* var_dump($redis->copy('source1', 'exists', ['REPLACE' => true]));
*/
public function copy(string $src, string $dst, ?array $options = null): Redis|bool;
/**
* Return the number of keys in the currently selected Redis database.
*
* @see https://redis.io/commands/dbsize
*
* @return Redis|int The number of keys or false on failure.
*
* @example
* $redis = new Redis(['host' => 'localhost']);
* $redis->flushdb();
* $redis->set('foo', 'bar');
* var_dump($redis->dbsize());
* $redis->mset(['a' => 'a', 'b' => 'b', 'c' => 'c', 'd' => 'd']);
* var_dump($redis->dbsize());
*/
public function dbSize(): Redis|int|false;
public function debug(string $key): Redis|string;
/**
* Decrement a Redis integer by 1 or a provided value.
*
* @param string $key The key to decrement
* @param int $by How much to decrement the key. Note that if this value is
* not sent or is set to `1`, PhpRedis will actually invoke
* the 'DECR' command. If it is any value other than `1`
* PhpRedis will actually send the `DECRBY` command.
*
* @return Redis|int|false The new value of the key or false on failure.
*
* @see https://redis.io/commands/decr
* @see https://redis.io/commands/decrby
*
* @example $redis->decr('counter');
* @example $redis->decr('counter', 2);
*/
public function decr(string $key, int $by = 1): Redis|int|false;
/**
* Decrement a redis integer by a value
*
* @param string $key The integer key to decrement.
* @param int $value How much to decrement the key.
*
* @return Redis|int|false The new value of the key or false on failure.
*
* @see https://redis.io/commands/decrby
*
* @example $redis->decrby('counter', 1);
* @example $redis->decrby('counter', 2);
*/
public function decrBy(string $key, int $value): Redis|int|false;
/**
* Delete one or more keys from Redis.
*
* This method can be called in two distinct ways. The first is to pass a single array
* of keys to delete, and the second is to pass N arguments, all names of keys. See
* below for an example of both strategies.
*
* @param array|string $key_or_keys Either an array with one or more key names or a string with
* the name of a key.
* @param string $other_keys One or more additional keys passed in a variadic fashion.
*
* @return Redis|int|false The number of keys that were deleted
*
* @see https://redis.io/commands/del
*
* @example $redis->del('key:0', 'key:1');
* @example $redis->del(['key:2', 'key:3', 'key:4']);
*/
public function del(array|string $key, string ...$other_keys): Redis|int|false;
/**
* Delete a key if it's equal to the specified value. This command is
* specific to Valkey >= 9.0
*
* @param string $key The key to delete
* @param mixed $value The value to compare against the key's value.
* @return Redis|int|false Returns 1 if the key was deleted, 0 if it was not.
*/
public function delifeq(string $key, mixed $value): Redis|int|false;
/**
* @deprecated
* @alias Redis::del
*/
public function delete(array|string $key, string ...$other_keys): Redis|int|false;
/**
* Discard a transaction currently in progress.
*
* @return Redis|bool True if we could discard the transaction.
*
* @example
* $redis->getMode();
* $redis->set('foo', 'bar');
* $redis->discard();
* $redis->getMode();
*/
public function discard(): Redis|bool;
/**
* Dump Redis' internal binary representation of a key.
*
* <code>
* $redis->zRange('new-zset', 0, -1, true);
* </code>
*
* @param string $key The key to dump.
*
* @return Redis|string A binary string representing the key's value.
*
* @see https://redis.io/commands/dump
*
* @example
* $redis->zadd('zset', 0, 'zero', 1, 'one', 2, 'two');
* $binary = $redis->dump('zset');
* $redis->restore('new-zset', 0, $binary);
*/
public function dump(string $key): Redis|string|false;
/**
* Have Redis repeat back an arbitrary string to the client.
*
* @param string $str The string to echo
*
* @return Redis|string|false The string sent to Redis or false on failure.
*
* @see https://redis.io/commands/echo
*
* @example $redis->echo('Hello, World');
*/
public function echo(string $str): Redis|string|false;
/**
* Execute a LUA script on the redis server.
*
* @see https://redis.io/commands/eval/
*
* @param string $script A string containing the LUA script
* @param array $args An array of arguments to pass to this script
* @param int $num_keys How many of the arguments are keys. This is needed
* as redis distinguishes between key name arguments
* and other data.
*
* @return mixed LUA scripts may return arbitrary data so this method can return
* strings, arrays, nested arrays, etc.
*/
public function eval(string $script, array $args = [], int $num_keys = 0): mixed;
/**
* This is simply the read-only variant of eval, meaning the underlying script
* may not modify data in redis.
*
* @see Redis::eval_ro()
*/
public function eval_ro(string $script_sha, array $args = [], int $num_keys = 0): mixed;
/**
* Execute a LUA script on the server but instead of sending the script, send
* the SHA1 hash of the script.
*
* @param string $script_sha The SHA1 hash of the lua code. Note that the script
* must already exist on the server, either having been
* loaded with `SCRIPT LOAD` or having been executed directly
* with `EVAL` first.
* @param array $args Arguments to send to the script.
* @param int $num_keys The number of arguments that are keys
*
* @return mixed Returns whatever the specific script does.
*
* @see https://redis.io/commands/evalsha/
* @see Redis::eval();
*
*/
public function evalsha(string $sha1, array $args = [], int $num_keys = 0): mixed;
/**
* This is simply the read-only variant of evalsha, meaning the underlying script
* may not modify data in redis.
*
* @see Redis::evalsha()
*/
public function evalsha_ro(string $sha1, array $args = [], int $num_keys = 0): mixed;
/**
* Execute either a MULTI or PIPELINE block and return the array of replies.
*
* @return Redis|array|false The array of pipeline'd or multi replies or false on failure.
*
* @see https://redis.io/commands/exec
* @see https://redis.io/commands/multi
* @see Redis::pipeline()
* @see Redis::multi()
*
* @example
* $res = $redis->multi()
* ->set('foo', 'bar')
* ->get('foo')
* ->del('list')
* ->rpush('list', 'one', 'two', 'three')
* ->exec();
*/
public function exec(): Redis|array|false;
/**
* Test if one or more keys exist.
*
* @param mixed $key Either an array of keys or a string key
* @param mixed $other_keys If the previous argument was a string, you may send any number of
* additional keys to test.
*
* @return Redis|int|bool The number of keys that do exist and false on failure
*
* @see https://redis.io/commands/exists
*
* @example $redis->exists(['k1', 'k2', 'k3']);
* @example $redis->exists('k4', 'k5', 'notakey');
*/
public function exists(mixed $key, mixed ...$other_keys): Redis|int|bool;
/**
* Sets an expiration in seconds on the key in question. If connected to
* redis-server >= 7.0.0 you may send an additional "mode" argument which
* modifies how the command will execute.
*
* @param string $key The key to set an expiration on.
* @param int $timeout The number of seconds after which key will be automatically deleted.
* @param string|null $mode A two character modifier that changes how the
* command works.
* <code>
* NX - Set expiry only if key has no expiry
* XX - Set expiry only if key has an expiry
* LT - Set expiry only when new expiry is < current expiry
* GT - Set expiry only when new expiry is > current expiry
* </code>
*
* @return Redis|bool True if an expiration was set and false otherwise.
* @see https://redis.io/commands/expire
*
*/
public function expire(string $key, int $timeout, ?string $mode = null): Redis|bool;
/*
* Set a key's expiration to a specific Unix timestamp in seconds.
*
* If connected to Redis >= 7.0.0 you can pass an optional 'mode' argument.
* @see Redis::expire() For a description of the mode argument.
*
* @param string $key The key to set an expiration on.
*
* @return Redis|bool True if an expiration was set, false if not.
*
*/
/**
* Set a key to expire at an exact unix timestamp.
*
* @param string $key The key to set an expiration on.
* @param int $timestamp The unix timestamp to expire at.
* @param string|null $mode An option 'mode' that modifies how the command acts (see {@link Redis::expire}).
* @return Redis|bool True if an expiration was set, false if not.
*
* @see https://redis.io/commands/expireat
* @see https://redis.io/commands/expire
* @see Redis::expire()
*/
public function expireAt(string $key, int $timestamp, ?string $mode = null): Redis|bool;
public function failover(?array $to = null, bool $abort = false, int $timeout = 0): Redis|bool;
/**
* Get the expiration of a given key as a unix timestamp
*
* @param string $key The key to check.
*
* @return Redis|int|false The timestamp when the key expires, or -1 if the key has no expiry
* and -2 if the key doesn't exist.
*
* @see https://redis.io/commands/expiretime
*
* @example
* $redis->setEx('mykey', 60, 'myval');
* $redis->expiretime('mykey');
*/
public function expiretime(string $key): Redis|int|false;
/**
* Get the expiration timestamp of a given Redis key but in milliseconds.
*
* @see https://redis.io/commands/pexpiretime
* @see Redis::expiretime()
*
* @param string $key The key to check
*
* @return Redis|int|false The expiration timestamp of this key (in milliseconds) or -1 if the
* key has no expiration, and -2 if it does not exist.
*/
public function pexpiretime(string $key): Redis|int|false;
/**
* Invoke a function.
*
* @param string $fn The name of the function
* @param array $keys Optional list of keys
* @param array $args Optional list of args
*
* @return mixed Function may return arbitrary data so this method can return
* strings, arrays, nested arrays, etc.
*
* @see https://redis.io/commands/fcall
*/
public function fcall(string $fn, array $keys = [], array $args = []): mixed;
/**
* This is a read-only variant of the FCALL command that cannot execute commands that modify data.
*
* @param string $fn The name of the function
* @param array $keys Optional list of keys
* @param array $args Optional list of args
*
* @return mixed Function may return arbitrary data so this method can return
* strings, arrays, nested arrays, etc.
*
* @see https://redis.io/commands/fcall_ro
*/
public function fcall_ro(string $fn, array $keys = [], array $args = []): mixed;
/**
* Deletes every key in all Redis databases
*
* @param bool $sync Whether to perform the task in a blocking or non-blocking way.
* @return bool
*
* @see https://redis.io/commands/flushall
*/
public function flushAll(?bool $sync = null): Redis|bool;
/**
* Deletes all the keys of the currently selected database.
*
* @param bool $sync Whether to perform the task in a blocking or non-blocking way.
* @return bool
*
* @see https://redis.io/commands/flushdb
*/
public function flushDB(?bool $sync = null): Redis|bool;
/**
* Functions is an API for managing code to be executed on the server.
*
* @param string $operation The subcommand you intend to execute. Valid options are as follows
* 'LOAD' - Create a new library with the given library name and code.
* 'DELETE' - Delete the given library.
* 'LIST' - Return general information on all the libraries
* 'STATS' - Return information about the current function running
* 'KILL' - Kill the current running function
* 'FLUSH' - Delete all the libraries
* 'DUMP' - Return a serialized payload representing the current libraries
* 'RESTORE' - Restore the libraries represented by the given payload
* @param member $args Additional arguments
*
* @return Redis|bool|string|array Depends on subcommand.
*
* @see https://redis.io/commands/function
*/
public function function(string $operation, mixed ...$args): Redis|bool|string|array;
/**
* Add one or more members to a geospacial sorted set
*
* @param string $key The sorted set to add data to.
* @param float $lng The longitude of the first member
* @param float $lat The latitude of the first member.
* @param member $other_triples_and_options You can continue to pass longitude, latitude, and member
* arguments to add as many members as you wish. Optionally, the final argument may be
* a string with options for the command @see Redis documentation for the options.
*
* @return Redis|int|false The number of added elements is returned. If the 'CH' option is specified,
* the return value is the number of members *changed*.
*
* @example $redis->geoAdd('cities', -121.8374, 39.7284, 'Chico', -122.03218, 37.322, 'Cupertino');
* @example $redis->geoadd('cities', -121.837478, 39.728494, 'Chico', ['XX', 'CH']);
*
* @see https://redis.io/commands/geoadd
*/
public function geoadd(string $key, float $lng, float $lat, string $member, mixed ...$other_triples_and_options): Redis|int|false;
/**
* Get the distance between two members of a geospacially encoded sorted set.
*
* @param string $key The Sorted set to query.
* @param string $src The first member.
* @param string $dst The second member.
* @param string $unit Which unit to use when computing distance, defaulting to meters.
* <code>
* M - meters
* KM - kilometers
* FT - feet
* MI - miles
* </code>
*
* @return Redis|float|false The calculated distance in whichever units were specified or false
* if one or both members did not exist.
*
* @example $redis->geodist('cities', 'Chico', 'Cupertino', 'mi');
*
* @see https://redis.io/commands/geodist
*/
public function geodist(string $key, string $src, string $dst, ?string $unit = null): Redis|float|false;
/**
* Retrieve one or more GeoHash encoded strings for members of the set.
*
* @param string $key The key to query
* @param string $member The first member to request
* @param string $other_members One or more additional members to request.
*
* @return Redis|array|false An array of GeoHash encoded values.
*
* @see https://redis.io/commands/geohash
* @see https://en.wikipedia.org/wiki/Geohash
*
* @example $redis->geohash('cities', 'Chico', 'Cupertino');
*/
public function geohash(string $key, string $member, string ...$other_members): Redis|array|false;
/**
* Return the longitude and latitude for one or more members of a geospacially encoded sorted set.
*
* @param string $key The set to query.
* @param string $member The first member to query.
* @param string $other_members One or more members to query.
*
* @return An array of longitude and latitude pairs.
*
* @see https://redis.io/commands/geopos
*
* @example $redis->geopos('cities', 'Seattle', 'New York');
*/
public function geopos(string $key, string $member, string ...$other_members): Redis|array|false;
/**
* Retrieve members of a geospacially sorted set that are within a certain radius of a location.
*
* @param string $key The set to query
* @param float $lng The longitude of the location to query.
* @param float $lat The latitude of the location to query.
* @param float $radius The radius of the area to include.
* @param string $unit The unit of the provided radius (defaults to 'meters).
* See {@link Redis::geodist} for possible units.
* @param array $options An array of options that modifies how the command behaves.
* <code>
* $options = [
* 'WITHCOORD', # Return members and their coordinates.
* 'WITHDIST', # Return members and their distances from the center.
* 'WITHHASH', # Return members GeoHash string.
* 'ASC' | 'DESC', # The sort order of returned members
*
* # Limit to N returned members. Optionally a two element array may be
* # passed as the `LIMIT` argument, and the `ANY` argument.
* 'COUNT' => [<int>], or [<int>, <bool>]
*
* # Instead of returning members, store them in the specified key.
* 'STORE' => <string>
*
* # Store the distances in the specified key
* 'STOREDIST' => <string>
* ];
* </code>
*
* @return mixed This command can return various things, depending on the options passed.
*
* @see https://redis.io/commands/georadius
*
* @example $redis->georadius('cities', 47.608013, -122.335167, 1000, 'km');
*/
public function georadius(string $key, float $lng, float $lat, float $radius, string $unit, array $options = []): mixed;
/**
* A readonly variant of `GEORADIUS` that may be executed on replicas.
*
* @see Redis::georadius
*/
public function georadius_ro(string $key, float $lng, float $lat, float $radius, string $unit, array $options = []): mixed;
/**
* Similar to `GEORADIUS` except it uses a member as the center of the query.
*
* @param string $key The key to query.
* @param string $member The member to treat as the center of the query.
* @param float $radius The radius from the member to include.
* @param string $unit The unit of the provided radius
* See {@link Redis::geodist} for possible units.
* @param array $options An array with various options to modify the command's behavior.
* See {@link Redis::georadius} for options.
*
* @return mixed This command can return various things depending on options.
*
* @example $redis->georadiusbymember('cities', 'Seattle', 200, 'mi');
*/
public function georadiusbymember(string $key, string $member, float $radius, string $unit, array $options = []): mixed;
/**
* This is the read-only variant of `GEORADIUSBYMEMBER` that can be run on replicas.
*/
public function georadiusbymember_ro(string $key, string $member, float $radius, string $unit, array $options = []): mixed;
/**
* Search a geospacial sorted set for members in various ways.
*
* @param string $key The set to query.
* @param array|string $position Either a two element array with longitude and latitude, or
* a string representing a member of the set.
* @param array|int|float $shape Either a number representine the radius of a circle to search, or
* a two element array representing the width and height of a box
* to search.
* @param string $unit The unit of our shape. See {@link Redis::geodist} for possible units.
* @param array $options @see {@link Redis::georadius} for options. Note that the `STORE`
* options are not allowed for this command.
*/
public function geosearch(string $key, array|string $position, array|int|float $shape, string $unit, array $options = []): array;
/**
* Search a geospacial sorted set for members within a given area or range, storing the results into
* a new set.
*
* @param string $dst The destination where results will be stored.
* @param string $src The key to query.
* @param array|string $position Either a two element array with longitude and latitude, or
* a string representing a member of the set.
* @param array|int|float $shape Either a number representine the radius of a circle to search, or
* a two element array representing the width and height of a box
* to search.
* @param string $unit The unit of our shape. See {@link Redis::geodist} for possible units.
* @param array $options
* <code>
* $options = [
* 'ASC' | 'DESC', # The sort order of returned members
* 'WITHDIST' # Also store distances.
*
* # Limit to N returned members. Optionally a two element array may be
* # passed as the `LIMIT` argument, and the `ANY` argument.
* 'COUNT' => [<int>], or [<int>, <bool>]
* ];
* </code>
*/
public function geosearchstore(string $dst, string $src, array|string $position, array|int|float $shape, string $unit, array $options = []): Redis|array|int|false;
/**
* Retrieve a string keys value.
*
* @param string $key The key to query
* @return mixed The keys value or false if it did not exist.
*
* @see https://redis.io/commands/get
*
* @example $redis->get('foo');
*/
public function get(string $key): mixed;
/**
* Retrieve a value and metadata of key.
*
* @param string $key The key to query
* @return Redis|array|false
*
* @example $redis->getWithMeta('foo');
*/
public function getWithMeta(string $key): Redis|array|false;
/**
* Get the authentication information on the connection, if any.
*
* @return mixed The authentication information used to authenticate the connection.
*
* @see Redis::auth()
*/
public function getAuth(): mixed;
/**
* Get the bit at a given index in a string key.
*
* @param string $key The key to query.
* @param int $idx The Nth bit that we want to query.
*
* @example $redis->getbit('bitmap', 1337);
*
* @see https://redis.io/commands/getbit
*/
public function getBit(string $key, int $idx): Redis|int|false;
/**
* Get the value of a key and optionally set it's expiration.
*
* @param string $key The key to query
* @param array $options Options to modify how the command works.
* <code>
* $options = [
* 'EX' => <seconds> # Expire in N seconds
* 'PX' => <milliseconds> # Expire in N milliseconds
* 'EXAT' => <timestamp> # Expire at a unix timestamp (in seconds)
* 'PXAT' => <mstimestamp> # Expire at a unix timestamp (in milliseconds);
* 'PERSIST' # Remove any configured expiration on the key.
* ];
* </code>
*
* @return Redis|string|bool The key's value or false if it didn't exist.
*
* @see https://redis.io/commands/getex
*
* @example $redis->getEx('mykey', ['EX' => 60]);
*/
public function getEx(string $key, array $options = []): Redis|string|bool;
/**
* Get the database number PhpRedis thinks we're connected to.
*
* This value is updated internally in PhpRedis each time {@link Redis::select} is called.
*
* @return The database we're connected to.
*
* @see Redis::select()
* @see https://redis.io/commands/select
*/
public function getDBNum(): int;
/**
* Get a key from Redis and delete it in an atomic operation.
*
* @param string $key The key to get/delete.
* @return Redis|string|bool The value of the key or false if it didn't exist.
*
* @see https://redis.io/commands/getdel
*
* @example $redis->getdel('token:123');
*/
public function getDel(string $key): Redis|string|bool;
/**
* Return the host or Unix socket we are connected to.
*
* @return string The host or Unix socket.
*/
public function getHost(): string;
/**
* Get the last error returned to us from Redis, if any.
*
* @return string The error string or NULL if there is none.
*/
public function getLastError(): ?string;
/**
* Returns whether the connection is in ATOMIC, MULTI, or PIPELINE mode
*
* @return int The mode we're in.
*
*/
public function getMode(): int;
/**
* Retrieve the value of a configuration setting as set by Redis::setOption()
*
* @see Redis::setOption() for a detailed list of options and their values.
*
* @return mixed The setting itself or false on failure
*/
public function getOption(int $option): mixed;
/**
* Get the persistent connection ID, if there is one.
*
* @return string The ID or NULL if we don't have one.
*/
public function getPersistentID(): ?string;
/**
* Get the port we are connected to. This number will be zero if we are connected to a unix socket.
*
* @return int The port.
*/
public function getPort(): int;
/**
* Get the server name as reported by the `HELLO` response.
*
* @return string|false
*/
public function serverName(): string|false;
/**
* Get the server version as reported by the `HELLO` response.
*
* @return string|false
*/
public function serverVersion(): string|false;
/**
* Retrieve a substring of a string by index.
*
* @param string $key The string to query.
* @param int $start The zero-based starting index.
* @param int $end The zero-based ending index.
*
* @return Redis|string|false The substring or false on failure.
*
* @see https://redis.io/commands/getrange
*
* @example
* $redis->set('silly-word', 'Supercalifragilisticexpialidocious');
* echo $redis->getRange('silly-word', 0, 4) . "\n";
*/
public function getRange(string $key, int $start, int $end): Redis|string|false;
/**
* Get the longest common subsequence between two string keys.
*
* @param string $key1 The first key to check
* @param string $key2 The second key to check
* @param array $options An optional array of modifiers for the command.
*
* <code>
* $options = [
* 'MINMATCHLEN' => int # Exclude matching substrings that are less than this value
*
* 'WITHMATCHLEN' => bool # Whether each match should also include its length.
*
* 'LEN' # Return the length of the longest subsequence
*
* 'IDX' # Each returned match will include the indexes where the
* # match occurs in each string.
* ];
* </code>
*
* NOTE: 'LEN' cannot be used with 'IDX'.
*
* @return Redis|string|array|int|false Various reply types depending on options.
*
* @see https://redis.io/commands/lcs
*
* @example
* $redis->set('seq1', 'gtaggcccgcacggtctttaatgtatccctgtttaccatgccatacctgagcgcatacgc');
* $redis->set('seq2', 'aactcggcgcgagtaccaggccaaggtcgttccagagcaaagactcgtgccccgctgagc');
* echo $redis->lcs('seq1', 'seq2') . "\n";
*/
public function lcs(string $key1, string $key2, ?array $options = null): Redis|string|array|int|false;
/**
* Get the currently set read timeout on the connection.
*
* @return float The timeout.
*/
public function getReadTimeout(): float;
/**
* Sets a key and returns any previously set value, if the key already existed.
*
* @param string $key The key to set.
* @param mixed $value The value to set the key to.
*
* @return Redis|string|false The old value of the key or false if it didn't exist.
*
* @see https://redis.io/commands/getset
*
* @example
* $redis->getset('captain', 'Pike');
* $redis->getset('captain', 'Kirk');
*/
public function getset(string $key, mixed $value): Redis|string|false;
/**
* Retrieve any set connection timeout
*
* @return float The currently set timeout or false on failure (e.g. we aren't connected).
*/
public function getTimeout(): float|false;
/**
* Get the number of bytes sent and received on the socket.
*
* @return array An array in the form [$sent_bytes, $received_bytes]
*/
public function getTransferredBytes(): array;
/**
* Reset the number of bytes sent and received on the socket.
*
* @return void
*/
public function clearTransferredBytes(): void;
/**
* Remove one or more fields from a hash.
*
* @param string $key The hash key in question.
* @param string $field The first field to remove
* @param string $other_fields One or more additional fields to remove.
*
* @return Redis|int|false The number of fields actually removed.
*
* @see https://redis.io/commands/hdel
*
* @example $redis->hDel('communication', 'Alice', 'Bob');
*/
public function hDel(string $key, string $field, string ...$other_fields): Redis|int|false;
/**
* Checks whether a field exists in a hash.
*
* @param string $key The hash to query.
* @param string $field The field to check
*
* @return Redis|bool True if it exists, false if not.
*
* @see https://redis.io/commands/hexists
*
* @example $redis->hExists('communication', 'Alice');
*/
public function hExists(string $key, string $field): Redis|bool;
public function hGet(string $key, string $member): mixed;
/**
* Read every field and value from a hash.
*
* @param string $key The hash to query.
* @return Redis|array<string|int, mixed>|false All fields and values or false if the key didn't exist.
*
* @see https://redis.io/commands/hgetall
*
* @example $redis->hgetall('myhash');
*/
public function hGetAll(string $key): Redis|array|false;
/**
* Retrieve a value and metadata of hash field.
*
* @param string $key The key to query
* @param string $member The key to query
* @return mixed
*
* @example $redis->hgetWithMeta('foo', 'field');
*/
public function hGetWithMeta(string $key, string $member): mixed;
/**
* Increment a hash field's value by an integer
*
* @param string $key The hash to modify
* @param string $field The field to increment
* @param int $value How much to increment the value.
*
* @return Redis|int|false The new value of the field.
*
* @see https://redis.io/commands/hincrby
*
* @example
* $redis->hMSet('player:1', ['name' => 'Alice', 'score' => 0]);
* $redis->hincrby('player:1', 'score', 10);
*
*/
public function hIncrBy(string $key, string $field, int $value): Redis|int|false;
/**
* Increment a hash field by a floating point value
*
* @param string $key The hash with the field to increment.
* @param string $field The field to increment.
*
* @return Redis|float|false The field value after incremented.
*
* @see https://redis.io/commands/hincrbyfloat
*
* @example
* $redis->hincrbyfloat('numbers', 'tau', 2 * 3.1415926);
*/
public function hIncrByFloat(string $key, string $field, float $value): Redis|float|false;
/**
* Retrieve all of the fields of a hash.
*
* @param string $key The hash to query.
*
* @return Redis|list<string>|false The fields in the hash or false if the hash doesn't exist.
*
* @see https://redis.io/commands/hkeys
*
* @example $redis->hkeys('myhash');
*/
public function hKeys(string $key): Redis|array|false;
/**
* Get the number of fields in a hash.
*
* @see https://redis.io/commands/hlen
*
* @param string $key The hash to check.
*
* @return Redis|int|false The number of fields or false if the key didn't exist.
*
* @example $redis->hlen('myhash');
*/
public function hLen(string $key): Redis|int|false;
/**
* Get one or more fields from a hash.
*
* @param string $key The hash to query.
* @param array $fields One or more fields to query in the hash.
*
* @return Redis|array|false The fields and values or false if the key didn't exist.
*
* @see https://redis.io/commands/hmget
*
* @example $redis->hMGet('player:1', ['name', 'score']);
*/
public function hMget(string $key, array $fields): Redis|array|false;
/**
* Get one or more fields of a hash while optionally setting expiration
* information
*
* @param string $key The hash to query.
* @param array $fields One or more fields to query in the hash.
* @param string|array $expiry Info about the expiration
*
* @return Redis|array|false The fields and values or false if the key didn't exist.
*/
public function hgetex(string $key, array $fields, string|array|null $expiry = null): Redis|array|false;
/**
* Set one or more fields in a hash with optional expiration information.
*
* @param string $key The hash to create/update.
* @param array $fields An array with fields values.
* @param array|null $expiry Info about the expiration
*
* @return Redis|int|false One if fields were set zero if not.
*/
public function hsetex(string $key, array $fields, ?array $expiry = null): Redis|int|false;
/**
* Get one or more fields and delete them
*
* @param string $key The hash in question
* @param array $fields One or more fields
*
* @return Redis|array|false The field and values or false on failure
*/
public function hgetdel(string $key, array $fields): Redis|array|false;
/**
* Add or update one or more hash fields and values
*
* @param string $key The hash to create/update
* @param array $fieldvals An associative array with fields and their values.
*
* @return Redis|bool True if the operation was successful
*
* @see https://redis.io/commands/hmset
*
* @example $redis->hmset('updates', ['status' => 'starting', 'elapsed' => 0]);
*/
public function hMset(string $key, array $fieldvals): Redis|bool;
/**
* Get one or more random field from a hash.
*
* @param string $key The hash to query.
* @param array $options An array of options to modify how the command behaves.
*
* <code>
* $options = [
* 'COUNT' => int # An optional number of fields to return.
* 'WITHVALUES' => bool # Also return the field values.
* ];
* </code>
*
* @return Redis|array|string One or more random fields (and possibly values).
*
* @see https://redis.io/commands/hrandfield
*
* @example $redis->hrandfield('settings');
* @example $redis->hrandfield('settings', ['count' => 2, 'withvalues' => true]);
*/
public function hRandField(string $key, ?array $options = null): Redis|string|array|false;
/**
* Add or update one or more hash fields and values.
*
* @param string $key The hash to create/update.
* @param mixed $fields_and_vals Argument pairs of fields and values. Alternatively, an associative array with the
* fields and their values.
*
* @return Redis|int|false The number of fields that were added, or false on failure.
*
* @see https://redis.io/commands/hset/
*
* @example $redis->hSet('player:1', 'name', 'Kim', 'score', 78);
* @example $redis->hSet('player:1', ['name' => 'Kim', 'score' => 78]);
*/
public function hSet(string $key, mixed ...$fields_and_vals): Redis|int|false;
/**
* Set a hash field and value, but only if that field does not exist
*
* @param string $key The hash to update.
* @param string $field The value to set.
*
* @return Redis|bool True if the field was set and false if not.
*
* @see https://redis.io/commands/hsetnx
*
* @example
* $redis->hsetnx('player:1', 'lock', 'enabled');
* $redis->hsetnx('player:1', 'lock', 'enabled');
*/
public function hSetNx(string $key, string $field, mixed $value): Redis|bool;
/**
* Get the string length of a hash field
*
* @param string $key The hash to query.
* @param string $field The field to query.
*
* @return Redis|int|false The string length of the field or false.
*
* @example
* $redis = new Redis(['host' => 'localhost']);
* $redis->del('hash');
* $redis->hmset('hash', ['50bytes' => str_repeat('a', 50)]);
* $redis->hstrlen('hash', '50bytes');
*
* @see https://redis.io/commands/hstrlen
*/
public function hStrLen(string $key, string $field): Redis|int|false;
/**
* Get all of the values from a hash.
*
* @param string $key The hash to query.
*
* @return Redis|list<mixed>|false The values from the hash.
*
* @see https://redis.io/commands/hvals
*
* @example $redis->hvals('player:1');
*/
public function hVals(string $key): Redis|array|false;
/**
* Set the expiration on one or more fields in a hash.
*
* @param string $key The hash to update.
* @param int $ttl The time to live in seconds.
* @param array $fields The fields to set the expiration on.
* @param string|null $option An optional mode (NX, XX, ETC)
* @return Redis|array|false
*
* @see https://redis.io/commands/hexpire
*/
public function hexpire(string $key, int $ttl, array $fields,
?string $mode = NULL): Redis|array|false;
/**
* Set the expiration on one or more fields in a hash in milliseconds.
*
* @param string $key The hash to update.
* @param int $ttl The time to live in milliseconds.
* @param array $fields The fields to set the expiration on.
* @param string|null $option An optional mode (NX, XX, ETC)
* @return Redis|array|false
*
* @see https://redis.io/commands/hexpire
*/
public function hpexpire(string $key, int $ttl, array $fields,
?string $mode = NULL): Redis|array|false;
/**
* Set the expiration time on one or more fields of a hash.
*
* @param string $key The hash to update.
* @param int $time The time to live in seconds.
* @param array $fields The fields to set the expiration on.
* @param string|null $option An optional mode (NX, XX, ETC)
* @return Redis|array|false
*
* @see https://redis.io/commands/hexpire
*/
public function hexpireat(string $key, int $time, array $fields,
?string $mode = NULL): Redis|array|false;
/**
* Set the expiration time on one or more fields of a hash in milliseconds.
*
* @param string $key The hash to update.
* @param int $mstime The time to live in milliseconds.
* @param array $fields The fields to set the expiration on.
* @param string|null $option An optional mode (NX, XX, ETC)
* @return Redis|array|false
*
* @see https://redis.io/commands/hexpire
*/
public function hpexpireat(string $key, int $mstime, array $fields,
?string $mode = NULL): Redis|array|false;
/**
* Get the TTL of one or more fields in a hash
*
* @param string $key The hash to query.
* @param array $fields The fields to query.
*
* @return Redis|array|false
*
* @see https://redis.io/commands/httl
*/
public function httl(string $key, array $fields): Redis|array|false;
/**
* Get the millisecond TTL of one or more fields in a hash
*
* @param string $key The hash to query.
* @param array $fields The fields to query.
*
* @return Redis|array|false
*
* @see https://redis.io/commands/hpttl
*/
public function hpttl(string $key, array $fields): Redis|array|false;
/**
* Get the expiration time of one or more fields in a hash
*
* @param string $key The hash to query.
* @param array $fields The fields to query.
*
* @return Redis|array|false
*
* @see https://redis.io/commands/hexpiretime
*/
public function hexpiretime(string $key, array $fields): Redis|array|false;
/**
* Get the expiration time in milliseconds of one or more fields in a hash
*
* @param string $key The hash to query.
* @param array $fields The fields to query.
*
* @return Redis|array|false
*
* @see https://redis.io/commands/hpexpiretime
*/
public function hpexpiretime(string $key, array $fields): Redis|array|false;
/**
* Persist one or more hash fields
*
* @param string $key The hash to query.
* @param array $fields The fields to query.
*
* @return Redis|array|false
*
* @see https://redis.io/commands/hpersist
*/
public function hpersist(string $key, array $fields): Redis|array|false;
/**
* Iterate over the fields and values of a hash in an incremental fashion.
*
* @see https://redis.io/commands/hscan
* @see https://redis.io/commands/scan
*
* @param string $key The hash to query.
* @param int $iterator The scan iterator, which should be initialized to NULL before the first call.
* This value will be updated after every call to hscan, until it reaches zero
* meaning the scan is complete.
* @param string|null $pattern An optional glob-style pattern to filter fields with.
* @param int $count An optional hint to Redis about how many fields and values to return per HSCAN.
*
* @return Redis|array|bool An array with a subset of fields and values.
*
* @example
* $redis = new Redis(['host' => 'localhost']);
*
* $redis->del('big-hash');
*
* for ($i = 0; $i < 1000; $i++) {
* $fields["field:$i"] = "value:$i";
* }
*
* $redis->hmset('big-hash', $fields);
*
* $it = null;
*
* do {
* // Scan the hash but limit it to fields that match '*:1?3'
* $fields = $redis->hscan('big-hash', $it, '*:1?3');
*
* foreach ($fields as $field => $value) {
* echo "[$field] => $value\n";
* }
* } while ($it != 0);
*/
public function hscan(string $key, null|int|string &$iterator, ?string $pattern = null, int $count = 0): Redis|array|bool;
/**
* Set an expiration on a key member (KeyDB only).
*
* @see https://docs.keydb.dev/docs/commands/#expiremember
*
* @param string $key The key to expire
* @param string $field The field to expire
* @param string|null $unit The unit of the ttl (s, or ms).
*/
public function expiremember(string $key, string $field, int $ttl, ?string $unit = null): Redis|int|false;
/**
* Set an expiration on a key membert to a specific unix timestamp (KeyDB only).
*
* @see https://docs.keydb.dev/docs/commands/#expirememberat
*
* @param string $key The key to expire
* @param string $field The field to expire
* @param int $timestamp The unix timestamp to expire at.
*/
public function expirememberat(string $key, string $field, int $timestamp): Redis|int|false;
/**
* Increment a key's value, optionally by a specific amount.
*
* @see https://redis.io/commands/incr
* @see https://redis.io/commands/incrby
*
* @param string $key The key to increment
* @param int $by An optional amount to increment by.
*
* @return Redis|int|false The new value of the key after incremented.
*
* @example $redis->incr('mycounter');
* @example $redis->incr('mycounter', 10);
*/
public function incr(string $key, int $by = 1): Redis|int|false;
/**
* Increment a key by a specific integer value
*
* @see https://redis.io/commands/incrby
*
* @param string $key The key to increment.
* @param int $value The amount to increment.
*
* @example
* $redis->set('primes', 2);
* $redis->incrby('primes', 1);
* $redis->incrby('primes', 2);
* $redis->incrby('primes', 2);
* $redis->incrby('primes', 4);
*/
public function incrBy(string $key, int $value): Redis|int|false;
/**
* Increment a numeric key by a floating point value.
*
* @param string $key The key to increment
* @param floag $value How much to increment (or decrement) the value.
*
* @return Redis|float|false The new value of the key or false if the key didn't contain a string.
*
* @example
* $redis->incrbyfloat('tau', 3.1415926);
* $redis->incrbyfloat('tau', 3.1415926);
*/
public function incrByFloat(string $key, float $value): Redis|float|false;
/**
* Retrieve information about the connected redis-server. If no arguments are passed to
* this function, redis will return every info field. Alternatively you may pass a specific
* section you want returned (e.g. 'server', or 'memory') to receive only information pertaining
* to that section.
*
* If connected to Redis server >= 7.0.0 you may pass multiple optional sections.
*
* @see https://redis.io/commands/info/
*
* @param string $sections Optional section(s) you wish Redis server to return.
*
* @return Redis|array|false
*/
public function info(string ...$sections): Redis|array|false;
/**
* Check if we are currently connected to a Redis instance.
*
* @return bool True if we are, false if not
*/
public function isConnected(): bool;
/**
* @param string $pattern
* @return Redis|list<string>|false
*/
public function keys(string $pattern);
/**
* @param mixed $elements
* @return Redis|int|false
*/
public function lInsert(string $key, string $pos, mixed $pivot, mixed $value);
/**
* Retrieve the length of a list.
*
* @param string $key The list
*
* @return Redis|int|false The number of elements in the list or false on failure.
*/
public function lLen(string $key): Redis|int|false;
/**
* Move an element from one list into another.
*
* @param string $src The source list.
* @param string $dst The destination list
* @param string $wherefrom Where in the source list to retrieve the element. This can be either
* - `Redis::LEFT`, or `Redis::RIGHT`.
* @param string $whereto Where in the destination list to put the element. This can be either
* - `Redis::LEFT`, or `Redis::RIGHT`.
* @return Redis|string|false The element removed from the source list.
*
* @example
* $redis->rPush('numbers', 'one', 'two', 'three');
* $redis->lMove('numbers', 'odds', Redis::LEFT, Redis::LEFT);
*/
public function lMove(string $src, string $dst, string $wherefrom, string $whereto): Redis|string|false;
/**
* Move an element from one list to another, blocking up to a timeout until an element is available.
*
* @param string $src The source list
* @param string $dst The destination list
* @param string $wherefrom Where in the source list to extract the element.
* - `Redis::LEFT`, or `Redis::RIGHT`.
* @param string $whereto Where in the destination list to put the element.
* - `Redis::LEFT`, or `Redis::RIGHT`.
* @param float $timeout How long to block for an element.
*
* @return Redis|string|false;
*
* @example
* @redis->lPush('numbers', 'one');
* @redis->blmove('numbers', 'odds', Redis::LEFT, Redis::LEFT 1.0);
* // This call will block, if no additional elements are in 'numbers'
* @redis->blmove('numbers', 'odds', Redis::LEFT, Redis::LEFT, 1.0);
*/
public function blmove(string $src, string $dst, string $wherefrom, string $whereto, float $timeout): Redis|string|false;
/**
* Pop one or more elements off a list.
*
* @param string $key The list to pop from.
* @param int $count Optional number of elements to remove. By default one element is popped.
* @return Redis|null|bool|int|array Will return the element(s) popped from the list or false/NULL
* if none was removed.
*
* @see https://redis.io/commands/lpop
*
* @example $redis->lpop('mylist');
* @example $redis->lpop('mylist', 4);
*/
public function lPop(string $key, int $count = 0): Redis|bool|string|array;
/**
* Retrieve the index of an element in a list.
*
* @param string $key The list to query.
* @param mixed $value The value to search for.
* @param array $options Options to configure how the command operates
* <code>
* $options = [
* # How many matches to return. By default a single match is returned.
* # If count is set to zero, it means unlimited.
* 'COUNT' => <num-matches>
*
* # Specify which match you want returned. `RANK` 1 means "the first match"
* # 2 means the second, and so on. If passed as a negative number the
* # RANK is computed right to left, so a `RANK` of -1 means "the last match".
* 'RANK' => <rank>
*
* # This argument allows you to limit how many elements Redis will search before
* # returning. This is useful to prevent Redis searching very long lists while
* # blocking the client.
* 'MAXLEN => <max-len>
* ];
* </code>
*
* @return Redis|null|bool|int|array Returns one or more of the matching indexes, or null/false if none were found.
*/
public function lPos(string $key, mixed $value, ?array $options = null): Redis|null|bool|int|array;
/**
* Prepend one or more elements to a list.
*
* @param string $key The list to prepend.
* @param mixed $elements One or more elements to prepend.
*
* @return Redis|int The new length of the list after prepending.
*
* @see https://redis.io/commands/lpush
*
* @example $redis->lPush('mylist', 'cat', 'bear', 'aligator');
*/
public function lPush(string $key, mixed ...$elements): Redis|int|false;
/**
* Append one or more elements to a list.
*
* @param string $key The list to append to.
* @param mixed $elements one or more elements to append.
*
* @return Redis|int|false The new length of the list
*
* @see https://redis.io/commands/rpush
*
* @example $redis->rPush('mylist', 'xray', 'yankee', 'zebra');
*/
public function rPush(string $key, mixed ...$elements): Redis|int|false;
/**
* Prepend an element to a list but only if the list exists
*
* @param string $key The key to prepend to.
* @param mixed $value The value to prepend.
*
* @return Redis|int|false The new length of the list.
*
*/
public function lPushx(string $key, mixed $value): Redis|int|false;
/**
* Append an element to a list but only if the list exists
*
* @param string $key The key to prepend to.
* @param mixed $value The value to prepend.
*
* @return Redis|int|false The new length of the list.
*
*/
public function rPushx(string $key, mixed $value): Redis|int|false;
/**
* Set a list element at an index to a specific value.
*
* @param string $key The list to modify.
* @param int $index The position of the element to change.
* @param mixed $value The new value.
*
* @return Redis|bool True if the list was modified.
*
* @see https://redis.io/commands/lset
*/
public function lSet(string $key, int $index, mixed $value): Redis|bool;
/**
* Retrieve the last time Redis' database was persisted to disk.
*
* @return int The unix timestamp of the last save time
*
* @see https://redis.io/commands/lastsave
*/
public function lastSave(): int;
/**
* Get the element of a list by its index.
*
* @param string $key The key to query
* @param int $index The index to check.
* @return mixed The index or NULL/false if the element was not found.
*/
public function lindex(string $key, int $index): mixed;
/**
* Retrieve elements from a list.
*
* @param string $key The list to query.
* @param int $start The beginning index to retrieve. This number can be negative
* meaning start from the end of the list.
* @param int $end The end index to retrieve. This can also be negative to start
* from the end of the list.
*
* @return Redis|array|false The range of elements between the indexes.
*
* @example $redis->lrange('mylist', 0, -1); // the whole list
* @example $redis->lrange('mylist', -2, -1); // the last two elements in the list.
*/
public function lrange(string $key, int $start , int $end): Redis|array|false;
/**
* Remove one or more matching elements from a list.
*
* @param string $key The list to truncate.
* @param mixed $value The value to remove.
* @param int $count How many elements matching the value to remove.
*
* @return Redis|int|false The number of elements removed.
*
* @see https://redis.io/commands/lrem
*/
public function lrem(string $key, mixed $value, int $count = 0): Redis|int|false;
/**
* Trim a list to a subrange of elements.
*
* @param string $key The list to trim
* @param int $start The starting index to keep
* @param int $end The ending index to keep.
*
* @return Redis|bool true if the list was trimmed.
*
* @example $redis->ltrim('mylist', 0, 3); // Keep the first four elements
*/
public function ltrim(string $key, int $start , int $end): Redis|bool;
/**
* Get one or more string keys.
*
* @param array $keys The keys to retrieve
* @return Redis|array|false an array of keys with their values.
*
* @example $redis->mget(['key1', 'key2']);
*/
public function mget(array $keys): Redis|array|false;
public function migrate(string $host, int $port, string|array $key, int $dstdb, int $timeout,
bool $copy = false, bool $replace = false,
#[\SensitiveParameter] mixed $credentials = null): Redis|bool;
/**
* Move a key to a different database on the same redis instance.
*
* @param string $key The key to move
* @return Redis|bool True if the key was moved
*/
public function move(string $key, int $index): Redis|bool;
/**
* Set one or more string keys.
*
* @param array $key_values An array with keys and their values.
* @return Redis|bool True if the keys could be set.
*
* @see https://redis.io/commands/mset
*
* @example $redis->mSet(['foo' => 'bar', 'baz' => 'bop']);
*/
public function mset(array $key_values): Redis|bool;
/**
* Set one or more string keys but only if none of the key exist.
*
* @param array $key_values An array of keys with their values.
*
* @return Redis|bool True if the keys were set and false if not.
*
* @see https://redis.io/commands/msetnx
*
* @example $redis->msetnx(['foo' => 'bar', 'baz' => 'bop']);
*/
public function msetnx(array $key_values): Redis|bool;
/**
* Begin a transaction.
*
* @param int $value The type of transaction to start. This can either be `Redis::MULTI` or
* `Redis::PIPELINE'.
*
* @return Redis|bool True if the transaction could be started.
*
* @see https://redis.io/commands/multi
*
* @example
* $redis->multi();
* $redis->set('foo', 'bar');
* $redis->get('foo');
* $redis->exec();
*/
public function multi(int $value = Redis::MULTI): bool|Redis;
public function object(string $subcommand, string $key): Redis|int|string|false;
/**
* @deprecated
* @alias Redis::connect
*/
public function open(string $host, int $port = 6379, float $timeout = 0, ?string $persistent_id = null, int $retry_interval = 0, float $read_timeout = 0, ?array $context = null): bool;
public function pconnect(string $host, int $port = 6379, float $timeout = 0, ?string $persistent_id = null, int $retry_interval = 0, float $read_timeout = 0, ?array $context = null): bool;
/**
* Remove the expiration from a key.
*
* @param string $key The key to operate against.
*
* @return Redis|bool True if a timeout was removed and false if it was not or the key didn't exist.
*/
public function persist(string $key): Redis|bool;
/**
* Sets an expiration in milliseconds on a given key. If connected to Redis >= 7.0.0
* you can pass an optional mode argument that modifies how the command will execute.
*
* @see Redis::expire() for a description of the mode argument.
*
* @param string $key The key to set an expiration on.
* @param int $timeout The number of milliseconds after which key will be automatically deleted.
* @param string|null $mode A two character modifier that changes how the
* command works.
*
* @return Redis|bool True if an expiry was set on the key, and false otherwise.
*/
public function pexpire(string $key, int $timeout, ?string $mode = null): bool;
/**
* Set a key's expiration to a specific Unix Timestamp in milliseconds. If connected to
* Redis >= 7.0.0 you can pass an optional 'mode' argument.
*
* @see Redis::expire() For a description of the mode argument.
*
* @param string $key The key to set an expiration on.
* @param int $timestamp The unix timestamp to expire at.
* @param string|null $mode A two character modifier that changes how the
* command works.
*
* @return Redis|bool True if an expiration was set on the key, false otherwise.
*/
public function pexpireAt(string $key, int $timestamp, ?string $mode = null): Redis|bool;
/**
* Add one or more elements to a Redis HyperLogLog key
*
* @see https://redis.io/commands/pfadd
*
* @param string $key The key in question.
*
* @param array $elements One or more elements to add.
*
* @return Redis|int Returns 1 if the set was altered, and zero if not.
*/
public function pfadd(string $key, array $elements): Redis|int;
/**
* Retrieve the cardinality of a Redis HyperLogLog key.
*
* @see https://redis.io/commands/pfcount
*
* @param string $key_or_keys Either one key or an array of keys
*
* @return Redis|int The estimated cardinality of the set.
*/
public function pfcount(array|string $key_or_keys): Redis|int|false;
/**
* Merge one or more source HyperLogLog sets into a destination set.
*
* @see https://redis.io/commands/pfmerge
*
* @param string $dst The destination key.
* @param array $srckeys One or more source keys.
*
* @return Redis|bool Always returns true.
*/
public function pfmerge(string $dst, array $srckeys): Redis|bool;
/**
* PING the redis server with an optional string argument.
*
* @see https://redis.io/commands/ping
*
* @param string $message An optional string message that Redis will reply with, if passed.
*
* @return Redis|string|false If passed no message, this command will simply return `true`.
* If a message is passed, it will return the message.
*
* @example $redis->ping();
* @example $redis->ping('beep boop');
*/
public function ping(?string $message = null): Redis|string|bool;
/**
* Enter into pipeline mode.
*
* Pipeline mode is the highest performance way to send many commands to Redis
* as they are aggregated into one stream of commands and then all sent at once
* when the user calls Redis::exec().
*
* NOTE: That this is shorthand for Redis::multi(Redis::PIPELINE)
*
* @return Redis The redis object is returned, to facilitate method chaining.
*
* @example
* $redis->pipeline()
* ->set('foo', 'bar')
* ->del('mylist')
* ->rpush('mylist', 'a', 'b', 'c')
* ->exec();
*/
public function pipeline(): bool|Redis;
/**
* @deprecated
* @alias Redis::pconnect
*/
public function popen(string $host, int $port = 6379, float $timeout = 0, ?string $persistent_id = null, int $retry_interval = 0, float $read_timeout = 0, ?array $context = null): bool;
/**
* Set a key with an expiration time in milliseconds
*
* @param string $key The key to set
* @param int $expire The TTL to set, in milliseconds.
* @param mixed $value The value to set the key to.
*
* @return Redis|bool True if the key could be set.
*
* @example $redis->psetex('mykey', 1000, 'myval');
*/
public function psetex(string $key, int $expire, mixed $value): Redis|bool;
/**
* Subscribe to one or more glob-style patterns
*
* @param array $patterns One or more patterns to subscribe to.
* @param callable $cb A callback with the following prototype:
*
* <code>
* function ($redis, $channel, $message) { }
* </code>
*
* @see https://redis.io/commands/psubscribe
*
* @return bool True if we were subscribed.
*/
public function psubscribe(array $patterns, callable $cb): bool;
/**
* Get a keys time to live in milliseconds.
*
* @param string $key The key to check.
*
* @return Redis|int|false The key's TTL or one of two special values if it has none.
* <code>
* -1 - The key has no TTL.
* -2 - The key did not exist.
* </code>
*
* @see https://redis.io/commands/pttl
*
* @example $redis->pttl('ttl-key');
*/
public function pttl(string $key): Redis|int|false;
/**
* Publish a message to a pubsub channel
*
* @see https://redis.io/commands/publish
*
* @param string $channel The channel to publish to.
* @param string $message The message itself.
*
* @return Redis|int The number of subscribed clients to the given channel.
*/
public function publish(string $channel, string $message): Redis|int|false;
public function pubsub(string $command, mixed $arg = null): mixed;
/**
* Unsubscribe from one or more channels by pattern
*
* @see https://redis.io/commands/punsubscribe
* @see https://redis.io/commands/subscribe
* @see Redis::subscribe()
*
* @param array $patterns One or more glob-style patterns of channel names.
*
* @return Redis|array|bool The array of subscribed patterns or false on failure.
*/
public function punsubscribe(array $patterns): Redis|array|bool;
/**
* Pop one or more elements from the end of a list.
*
* @param string $key A redis LIST key name.
* @param int $count The maximum number of elements to pop at once.
* NOTE: The `count` argument requires Redis >= 6.2.0
*
* @return Redis|array|string|bool One or more popped elements or false if all were empty.
*
* @see https://redis.io/commands/rpop
*
* @example $redis->rPop('mylist');
* @example $redis->rPop('mylist', 4);
*/
public function rPop(string $key, int $count = 0): Redis|array|string|bool;
/**
* Return a random key from the current database
*
* @see https://redis.io/commands/randomkey
*
* @return Redis|string|false A random key name or false if no keys exist
*
*/
public function randomKey(): Redis|string|false;
/**
* Execute any arbitrary Redis command by name.
*
* @param string $command The command to execute
* @param mixed $args One or more arguments to pass to the command.
*
* @return mixed Can return any number of things depending on command executed.
*
* @example $redis->rawCommand('del', 'mystring', 'mylist');
* @example $redis->rawCommand('set', 'mystring', 'myvalue');
* @example $redis->rawCommand('rpush', 'mylist', 'one', 'two', 'three');
*/
public function rawcommand(string $command, mixed ...$args): mixed;
/**
* Unconditionally rename a key from $old_name to $new_name
*
* @see https://redis.io/commands/rename
*
* @param string $old_name The original name of the key
* @param string $new_name The new name for the key
*
* @return Redis|bool True if the key was renamed or false if not.
*/
public function rename(string $old_name, string $new_name): Redis|bool;
/**
* Renames $key_src to $key_dst but only if newkey does not exist.
*
* @see https://redis.io/commands/renamenx
*
* @param string $key_src The source key name
* @param string $key_dst The destination key name.
*
* @return Redis|bool True if the key was renamed, false if not.
*
* @example
* $redis->set('src', 'src_key');
* $redis->set('existing-dst', 'i_exist');
*
* $redis->renamenx('src', 'dst');
* $redis->renamenx('dst', 'existing-dst');
*/
public function renameNx(string $key_src, string $key_dst): Redis|bool;
/**
* Reset the state of the connection.
*
* @return Redis|bool Should always return true unless there is an error.
*/
public function reset(): Redis|bool;
/**
* Restore a key by the binary payload generated by the DUMP command.
*
* @param string $key The name of the key you wish to create.
* @param int $ttl What Redis should set the key's TTL (in milliseconds) to once it is created.
* Zero means no TTL at all.
* @param string $value The serialized binary value of the string (generated by DUMP).
* @param array $options An array of additional options that modifies how the command operates.
*
* <code>
* $options = [
* 'ABSTTL' # If this is present, the `$ttl` provided by the user should
* # be an absolute timestamp, in milliseconds()
*
* 'REPLACE' # This flag instructs Redis to store the key even if a key with
* # that name already exists.
*
* 'IDLETIME' => int # Tells Redis to set the keys internal 'idletime' value to a
* # specific number (see the Redis command OBJECT for more info).
* 'FREQ' => int # Tells Redis to set the keys internal 'FREQ' value to a specific
* # number (this relates to Redis' LFU eviction algorithm).
* ];
* </code>
*
* @return Redis|bool True if the key was stored, false if not.
*
* @see https://redis.io/commands/restore
* @see https://redis.io/commands/dump
* @see Redis::dump()
*
* @example
* $redis->sAdd('captains', 'Janeway', 'Picard', 'Sisko', 'Kirk', 'Archer');
* $serialized = $redis->dump('captains');
*
* $redis->restore('captains-backup', 0, $serialized);
*/
public function restore(string $key, int $ttl, string $value, ?array $options = null): Redis|bool;
/**
* Query whether the connected instance is a primary or replica
*
* @return mixed Will return an array with the role of the connected instance unless there is
* an error.
*/
public function role(): mixed;
/**
* Atomically pop an element off the end of a Redis LIST and push it to the beginning of
* another.
*
* @param string $srckey The source key to pop from.
* @param string $dstkey The destination key to push to.
*
* @return Redis|string|false The popped element or false if the source key was empty.
*
* @see https://redis.io/commands/rpoplpush
*
* @example
* $redis->pipeline()
* ->del('list1', 'list2')
* ->rpush('list1', 'list1-1', 'list1-2')
* ->rpush('list2', 'list2-1', 'list2-2')
* ->exec();
*
* $redis->rpoplpush('list2', 'list1');
*/
public function rpoplpush(string $srckey, string $dstkey): Redis|string|false;
/**
* Add one or more values to a Redis SET key.
*
* @param string $key The key name
* @param mixed $member A value to add to the set.
* @param mixed $other_members One or more additional values to add
*
* @return Redis|int|false The number of values added to the set.
*
* @see https://redis.io/commands/sadd
*
* @example
* $redis->del('myset');
*
* $redis->sadd('myset', 'foo', 'bar', 'baz');
* $redis->sadd('myset', 'foo', 'new');
*/
public function sAdd(string $key, mixed $value, mixed ...$other_values): Redis|int|false;
/**
* Add one or more values to a Redis SET key. This is an alternative to Redis::sadd() but
* instead of being variadic, takes a single array of values.
*
* @see https://redis.io/commands/sadd
* @see Redis::sadd()
*
* @param string $key The set to add values to.
* @param array $values One or more members to add to the set.
* @return Redis|int|false The number of members added to the set.
*
* @example
* $redis->del('myset');
*
* $redis->sAddArray('myset', ['foo', 'bar', 'baz']);
* $redis->sAddArray('myset', ['foo', 'new']);
*/
public function sAddArray(string $key, array $values): int;
/**
* Given one or more Redis SETS, this command returns all of the members from the first
* set that are not in any subsequent set.
*
* @param string $key The first set
* @param string $other_keys One or more additional sets
*
* @return Redis|array|false Returns the elements from keys 2..N that don't exist in the
* first sorted set, or false on failure.
*
* @see https://redis.io/commands/sdiff
*
* @example
* $redis->pipeline()
* ->del('set1', 'set2', 'set3')
* ->sadd('set1', 'apple', 'banana', 'carrot', 'date')
* ->sadd('set2', 'carrot')
* ->sadd('set3', 'apple', 'carrot', 'eggplant')
* ->exec();
*
* $redis->sdiff('set1', 'set2', 'set3');
*/
public function sDiff(string $key, string ...$other_keys): Redis|array|false;
/**
* This method performs the same operation as SDIFF except it stores the resulting diff
* values in a specified destination key.
*
* @see https://redis.io/commands/sdiffstore
* @see Redis::sdiff()
*
* @param string $dst The key where to store the result
* @param string $key The first key to perform the DIFF on
* @param string $other_keys One or more additional keys.
*
* @return Redis|int|false The number of values stored in the destination set or false on failure.
*/
public function sDiffStore(string $dst, string $key, string ...$other_keys): Redis|int|false;
/**
* Given one or more Redis SET keys, this command will return all of the elements that are
* in every one.
*
* @see https://redis.io/commands/sinter
*
* @param string $key The first SET key to intersect.
* @param string $other_keys One or more Redis SET keys.
*
* @example
* <code>
* $redis->pipeline()
* ->del('alice_likes', 'bob_likes', 'bill_likes')
* ->sadd('alice_likes', 'asparagus', 'broccoli', 'carrot', 'potato')
* ->sadd('bob_likes', 'asparagus', 'carrot', 'potato')
* ->sadd('bill_likes', 'broccoli', 'potato')
* ->exec();
*
* var_dump($redis->sinter('alice_likes', 'bob_likes', 'bill_likes'));
* </code>
*/
public function sInter(array|string $key, string ...$other_keys): Redis|array|false;
/**
* Compute the intersection of one or more sets and return the cardinality of the result.
*
* @param array $keys One or more set key names.
* @param int $limit A maximum cardinality to return. This is useful to put an upper bound
* on the amount of work Redis will do.
*
* @return Redis|int|false The
*
* @see https://redis.io/commands/sintercard
*
* @example
* <code>
* $redis->sAdd('set1', 'apple', 'pear', 'banana', 'carrot');
* $redis->sAdd('set2', 'apple', 'banana');
* $redis->sAdd('set3', 'pear', 'banana');
*
* $redis->sInterCard(['set1', 'set2', 'set3']);
* </code>
*/
public function sintercard(array $keys, int $limit = -1): Redis|int|false;
/**
* Perform the intersection of one or more Redis SETs, storing the result in a destination
* key, rather than returning them.
*
* @param array|string $key_or_keys Either a string key, or an array of keys (with at least two
* elements, consisting of the destination key name and one
* or more source keys names.
* @param string $other_keys If the first argument was a string, subsequent arguments should
* be source key names.
*
* @return Redis|int|false The number of values stored in the destination key or false on failure.
*
* @see https://redis.io/commands/sinterstore
* @see Redis::sinter()
* <code>
* @example $redis->sInterStore(['dst', 'src1', 'src2', 'src3']);
* @example $redis->sInterStore('dst', 'src1', 'src'2', 'src3');
* </code>
*/
public function sInterStore(array|string $key, string ...$other_keys): Redis|int|false;
/**
* Retrieve every member from a set key.
*
* @param string $key The set name.
*
* @return Redis|array|false Every element in the set or false on failure.
*
* @see https://redis.io/commands/smembers
*
* @example
* $redis->sAdd('tng-crew', ...['Picard', 'Riker', 'Data', 'Worf', 'La Forge', 'Troi', 'Crusher', 'Broccoli']);
* $redis->sMembers('tng-crew');
*/
public function sMembers(string $key): Redis|array|false;
/**
* Check if one or more values are members of a set.
*
* @see https://redis.io/commands/smismember
* @see https://redis.io/commands/smember
* @see Redis::smember()
*
* @param string $key The set to query.
* @param string $member The first value to test if exists in the set.
* @param string $other_members Any number of additional values to check.
*
* @return Redis|array|false An array of integers representing whether each passed value
* was a member of the set.
*
* @example
* $redis->sAdd('ds9-crew', ...["Sisko", "Kira", "Dax", "Worf", "Bashir", "O'Brien"]);
* $members = $redis->sMIsMember('ds9-crew', ...['Sisko', 'Picard', 'Data', 'Worf']);
*/
public function sMisMember(string $key, string $member, string ...$other_members): Redis|array|false;
/**
* Pop a member from one set and push it onto another. This command will create the
* destination set if it does not currently exist.
*
* @see https://redis.io/commands/smove
*
* @param string $src The source set.
* @param string $dst The destination set.
* @param mixed $value The member you wish to move.
*
* @return Redis|bool True if the member was moved, and false if it wasn't in the set.
*
* @example
* $redis->sAdd('numbers', 'zero', 'one', 'two', 'three', 'four');
* $redis->sMove('numbers', 'evens', 'zero');
* $redis->sMove('numbers', 'evens', 'two');
* $redis->sMove('numbers', 'evens', 'four');
*/
public function sMove(string $src, string $dst, mixed $value): Redis|bool;
/**
* Remove one or more elements from a set.
*
* @see https://redis.io/commands/spop
*
* @param string $key The set in question.
* @param int $count An optional number of members to pop. This defaults to
* removing one element.
*
* @example
* $redis->del('numbers', 'evens');
* $redis->sAdd('numbers', 'zero', 'one', 'two', 'three', 'four');
* $redis->sPop('numbers');
*/
public function sPop(string $key, int $count = 0): Redis|string|array|false;
/**
* Retrieve one or more random members of a set.
*
* @param string $key The set to query.
* @param int $count An optional count of members to return.
*
* If this value is positive, Redis will return *up to* the requested
* number but with unique elements that will never repeat. This means
* you may receive fewer then `$count` replies.
*
* If the number is negative, Redis will return the exact number requested
* but the result may contain duplicate elements.
*
* @return Redis|array|string|false One or more random members or false on failure.
*
* @see https://redis.io/commands/srandmember
*
* @example $redis->sRandMember('myset');
* @example $redis->sRandMember('myset', 10);
* @example $redis->sRandMember('myset', -10);
*/
public function sRandMember(string $key, int $count = 0): mixed;
/**
* Returns the union of one or more Redis SET keys.
*
* @see https://redis.io/commands/sunion
*
* @param string $key The first SET to do a union with
* @param string $other_keys One or more subsequent keys
*
* @return Redis|array|false The union of the one or more input sets or false on failure.
*
* @example $redis->sunion('set1', 'set2');
*/
public function sUnion(string $key, string ...$other_keys): Redis|array|false;
/**
* Perform a union of one or more Redis SET keys and store the result in a new set
*
* @see https://redis.io/commands/sunionstore
* @see Redis::sunion()
*
* @param string $dst The destination key
* @param string $key The first source key
* @param string $other_keys One or more additional source keys
*
* @return Redis|int|false The number of elements stored in the destination SET or
* false on failure.
*/
public function sUnionStore(string $dst, string $key, string ...$other_keys): Redis|int|false;
/**
* Persist the Redis database to disk. This command will block the server until the save is
* completed. For a nonblocking alternative, see Redis::bgsave().
*
* @see https://redis.io/commands/save
* @see Redis::bgsave()
*
* @return Redis|bool Returns true unless an error occurs.
*/
public function save(): Redis|bool;
/**
* Incrementally scan the Redis keyspace, with optional pattern and type matching.
*
* A note about Redis::SCAN_NORETRY and Redis::SCAN_RETRY.
*
* For convenience, PhpRedis can retry SCAN commands itself when Redis returns an empty array of
* keys with a nonzero iterator. This can happen when matching against a pattern that very few
* keys match inside a key space with a great many keys. The following example demonstrates how
* to use Redis::scan() with the option disabled and enabled.
*
* @param int $iterator The cursor returned by Redis for every subsequent call to SCAN. On
* the initial invocation of the call, it should be initialized by the
* caller to NULL. Each time SCAN is invoked, the iterator will be
* updated to a new number, until finally Redis will set the value to
* zero, indicating that the scan is complete.
*
* @param string|null $pattern An optional glob-style pattern for matching key names. If passed as
* NULL, it is the equivalent of sending '*' (match every key).
*
* @param int $count A hint to redis that tells it how many keys to return in a single
* call to SCAN. The larger the number, the longer Redis may block
* clients while iterating the key space.
*
* @param string $type An optional argument to specify which key types to scan (e.g.
* 'STRING', 'LIST', 'SET')
*
* @return array|false An array of keys, or false if no keys were returned for this
* invocation of scan. Note that it is possible for Redis to return
* zero keys before having scanned the entire key space, so the caller
* should instead continue to SCAN until the iterator reference is
* returned to zero.
*
* @see https://redis.io/commands/scan
* @see Redis::setOption()
*
* @example
* $redis = new Redis(['host' => 'localhost']);
*
* $redis->setOption(Redis::OPT_SCAN, Redis::SCAN_NORETRY);
*
* $it = null;
*
* do {
* $keys = $redis->scan($it, '*zorg*');
* foreach ($keys as $key) {
* echo "KEY: $key\n";
* }
* } while ($it != 0);
*
* $redis->setOption(Redis::OPT_SCAN, Redis::SCAN_RETRY);
*
* $it = null;
*
* // When Redis::SCAN_RETRY is enabled, we can use simpler logic, as we will never receive an
* // empty array of keys when the iterator is nonzero.
* while ($keys = $redis->scan($it, '*zorg*')) {
* foreach ($keys as $key) {
* echo "KEY: $key\n";
* }
* }
*/
public function scan(null|int|string &$iterator, ?string $pattern = null, int $count = 0, ?string $type = null): array|false;
/**
* Retrieve the number of members in a Redis set.
*
* @param string $key The set to get the cardinality of.
*
* @return Redis|int|false The cardinality of the set or false on failure.
*
* @see https://redis.io/commands/scard
*
* @example $redis->scard('set');
*/
public function scard(string $key): Redis|int|false;
/**
* An administrative command used to interact with LUA scripts stored on the server.
*
* @see https://redis.io/commands/script
*
* @param string $command The script suboperation to execute.
* @param mixed $args One or more additional argument
*
* @return mixed This command returns various things depending on the specific operation executed.
*
* @example $redis->script('load', 'return 1');
* @example $redis->script('exists', sha1('return 1'));
*/
public function script(string $command, mixed ...$args): mixed;
/**
* Select a specific Redis database.
*
* @param int $db The database to select. Note that by default Redis has 16 databases (0-15).
*
* @return Redis|bool true on success and false on failure
*
* @see https://redis.io/commands/select
*
* @example $redis->select(1);
*/
public function select(int $db): Redis|bool;
/**
* Create or set a Redis STRING key to a value.
*
* @param string $key The key name to set.
* @param mixed $value The value to set the key to.
* @param array|int $options Either an array with options for how to perform the set or an
* integer with an expiration. If an expiration is set PhpRedis
* will actually send the `SETEX` command.
*
* OPTION DESCRIPTION
* ------------ --------------------------------------------------------------
* ['EX' => 60] expire 60 seconds.
* ['PX' => 6000] expire in 6000 milliseconds.
* ['EXAT' => time() + 10] expire in 10 seconds.
* ['PXAT' => time()*1000 + 1000] expire in 1 second.
* ['KEEPTTL' => true] Redis will not update the key's current TTL.
* ['XX'] Only set the key if it already exists.
* ['NX'] Only set the key if it doesn't exist.
* ['GET'] Instead of returning `+OK` return the previous value of the
* key or NULL if the key didn't exist.
*
* @return Redis|string|bool True if the key was set or false on failure.
*
* @see https://redis.io/commands/set
* @see https://redis.io/commands/setex
*
* @example $redis->set('key', 'value');
* @example $redis->set('key', 'expires_in_60_seconds', 60);
*/
public function set(string $key, mixed $value, mixed $options = null): Redis|string|bool;
/**
* Set a specific bit in a Redis string to zero or one
*
* @see https://redis.io/commands/setbit
*
* @param string $key The Redis STRING key to modify
* @param bool $value Whether to set the bit to zero or one.
*
* @return Redis|int|false The original value of the bit or false on failure.
*
* @example
* $redis->set('foo', 'bar');
* $redis->setbit('foo', 7, 1);
*/
public function setBit(string $key, int $idx, bool $value): Redis|int|false;
/**
* Update or append to a Redis string at a specific starting index
*
* @see https://redis.io/commands/setrange
*
* @param string $key The key to update
* @param int $index Where to insert the provided value
* @param string $value The value to copy into the string.
*
* @return Redis|int|false The new length of the string or false on failure
*
* @example
* $redis->set('message', 'Hello World');
* $redis->setRange('message', 6, 'Redis');
*/
public function setRange(string $key, int $index, string $value): Redis|int|false;
/**
* Set a configurable option on the Redis object.
*
* Following are a list of options you can set:
*
* | OPTION | TYPE | DESCRIPTION |
* | --------------- | ---- | ----------- |
* | OPT_MAX_RETRIES | int | The maximum number of times Redis will attempt to reconnect if it gets disconnected, before throwing an exception. |
* | OPT_SCAN | enum | Redis::OPT_SCAN_RETRY, or Redis::OPT_SCAN_NORETRY. Whether PhpRedis should automatically SCAN again when zero keys but a nonzero iterator are returned. |
* | OPT_SERIALIZER | enum | Set the automatic data serializer.<br>`Redis::SERIALIZER_NONE`<br>`Redis::SERIALIZER_PHP`<br>`Redis::SERIALIZER_IGBINARY`<br>`Redis::SERIALIZER_MSGPACK`, `Redis::SERIALIZER_JSON`|
* | OPT_PREFIX | string | A string PhpRedis will use to prefix every key we read or write. |
* | OPT_READ_TIMEOUT | float | How long PhpRedis will block for a response from Redis before throwing a 'read error on connection' exception. |
* | OPT_TCP_KEEPALIVE | bool | Set or disable TCP_KEEPALIVE on the connection. |
* | OPT_COMPRESSION | enum | Set the compression algorithm<br>`Redis::COMPRESSION_NONE`<br>`Redis::COMPRESSION_LZF`<br>`Redis::COMPRESSION_LZ4`<br> `Redis::COMPRESSION_ZSTD` |
* | OPT_REPLY_LITERAL | bool | If set to true, PhpRedis will return the literal string Redis returns for LINE replies (e.g. '+OK'), rather than `true`. |
* | OPT_COMPRESSION_LEVEL | int | Set a specific compression level if Redis is compressing data. |
* | OPT_NULL_MULTIBULK_AS_NULL | bool | Causes PhpRedis to return `NULL` rather than `false` for NULL MULTIBULK replies |
* | OPT_BACKOFF_ALGORITHM | enum | The exponential backoff strategy to use. |
* | OPT_BACKOFF_BASE | int | The minimum delay between retries when backing off. |
* | OPT_BACKOFF_CAP | int | The maximum delay between replies when backing off. |
*
* @see Redis::getOption()
* @see Redis::__construct() for details about backoff strategies.
*
* @param int $option The option constant.
* @param mixed $value The option value.
*
* @return bool true if the setting was updated, false if not.
*
*/
public function setOption(int $option, mixed $value): bool;
/**
* Set a Redis STRING key with a specific expiration in seconds.
*
* @param string $key The name of the key to set.
* @param int $expire The key's expiration in seconds.
* @param mixed $value The value to set the key.
*
* @return Redis|bool True on success or false on failure.
*
* @example $redis->setex('60s-ttl', 60, 'some-value');
*/
public function setex(string $key, int $expire, mixed $value);
/**
* Set a key to a value, but only if that key does not already exist.
*
* @see https://redis.io/commands/setnx
*
* @param string $key The key name to set.
* @param mixed $value What to set the key to.
*
* @return Redis|bool Returns true if the key was set and false otherwise.
*
* @example $redis->setnx('existing-key', 'existing-value');
* @example $redis->setnx('new-key', 'new-value');
*/
public function setnx(string $key, mixed $value): Redis|bool;
/**
* Check whether a given value is the member of a Redis SET.
*
* @param string $key The redis set to check.
* @param mixed $value The value to test.
*
* @return Redis|bool True if the member exists and false if not.
*
* @example $redis->sismember('myset', 'mem1', 'mem2');
*/
public function sismember(string $key, mixed $value): Redis|bool;
/**
* Turn a redis instance into a replica of another or promote a replica
* to a primary.
*
* This method and the corresponding command in Redis has been marked deprecated
* and users should instead use Redis::replicaof() if connecting to redis-server
* >= 5.0.0.
*
* @deprecated
*
* @see https://redis.io/commands/slaveof
* @see https://redis.io/commands/replicaof
* @see Redis::replicaof()
*/
public function slaveof(?string $host = null, int $port = 6379): Redis|bool;
/**
* Used to turn a Redis instance into a replica of another, or to remove
* replica status promoting the instance to a primary.
*
* @see https://redis.io/commands/replicaof
* @see https://redis.io/commands/slaveof
* @see Redis::slaveof()
*
* @param string $host The host of the primary to start replicating.
* @param string $port The port of the primary to start replicating.
*
* @return Redis|bool Success if we were successfully able to start replicating a primary or
* were able to promote the replicat to a primary.
*
* @example
* $redis = new Redis(['host' => 'localhost']);
*
* // Attempt to become a replica of a Redis instance at 127.0.0.1:9999
* $redis->replicaof('127.0.0.1', 9999);
*
* // When passed no arguments, PhpRedis will deliver the command `REPLICAOF NO ONE`
* // attempting to promote the instance to a primary.
* $redis->replicaof();
*/
public function replicaof(?string $host = null, int $port = 6379): Redis|bool;
/**
* Update one or more keys last modified metadata.
*
* @see https://redis.io/commands/touch/
*
* @param array|string $key Either the first key or if passed as the only argument
* an array of keys.
* @param string $more_keys One or more keys to send to the command.
*
* @return Redis|int|false This command returns the number of keys that exist and
* had their last modified time reset
*/
public function touch(array|string $key_or_array, string ...$more_keys): Redis|int|false;
/**
* Interact with Redis' slowlog functionality in various ways, depending
* on the value of 'operation'.
*
* @category administration
*
* @param string $operation The operation you wish to perform.  This can
* be one of the following values:
* 'GET' - Retrieve the Redis slowlog as an array.
* 'LEN' - Retrieve the length of the slowlog.
* 'RESET' - Remove all slowlog entries.
* @param int $length This optional argument can be passed when operation
* is 'get' and will specify how many elements to retrieve.
* If omitted Redis will send up to a default number of
* entries, which is configurable.
*
* Note: With Redis >= 7.0.0 you can send -1 to mean "all".
*
* @return mixed
*
* @see https://redis.io/commands/slowlog/
*
* @example $redis->slowlog('get', -1); // Retrieve all slowlog entries.
* @example $redis->slowlog('len'); // Retrieve slowlog length.
* @example $redis->slowlog('reset'); // Reset the slowlog.
*/
public function slowlog(string $operation, int $length = 0): mixed;
/**
* Sort the contents of a Redis key in various ways.
*
* @see https://redis.io/commands/sort/
*
* @param string $key The key you wish to sort
* @param array $options Various options controlling how you would like the
* data sorted. See blow for a detailed description
* of this options array.
*
* @return mixed This command can either return an array with the sorted data
* or the number of elements placed in a destination set when
* using the STORE option.
*
* @example
* $options = [
* 'SORT' => 'ASC'|| 'DESC' // Sort in descending or descending order.
* 'ALPHA' => true || false // Whether to sort alphanumerically.
* 'LIMIT' => [0, 10] // Return a subset of the data at offset, count
* 'BY' => 'weight_*' // For each element in the key, read data from the
* external key weight_* and sort based on that value.
* 'GET' => 'weight_*' // For each element in the source key, retrieve the
* data from key weight_* and return that in the result
* rather than the source keys' element. This can
* be used in combination with 'BY'
* ];
*/
public function sort(string $key, ?array $options = null): mixed;
/**
* This is simply a read-only variant of the sort command
*
* @see Redis::sort()
*/
public function sort_ro(string $key, ?array $options = null): mixed;
/**
* @deprecated
*/
public function sortAsc(string $key, ?string $pattern = null, mixed $get = null, int $offset = -1, int $count = -1, ?string $store = null): array;
/**
* @deprecated
*/
public function sortAscAlpha(string $key, ?string $pattern = null, mixed $get = null, int $offset = -1, int $count = -1, ?string $store = null): array;
/**
* @deprecated
*/
public function sortDesc(string $key, ?string $pattern = null, mixed $get = null, int $offset = -1, int $count = -1, ?string $store = null): array;
/**
* @deprecated
*/
public function sortDescAlpha(string $key, ?string $pattern = null, mixed $get = null, int $offset = -1, int $count = -1, ?string $store = null): array;
/**
* Remove one or more values from a Redis SET key.
*
* @see https://redis.io/commands/srem
*
* @param string $key The Redis SET key in question.
* @param mixed $value The first value to remove.
* @param mixed $more_values One or more additional values to remove.
*
* @return Redis|int|false The number of values removed from the set or false on failure.
*
* @example $redis->sRem('set1', 'mem1', 'mem2', 'not-in-set');
*/
public function srem(string $key, mixed $value, mixed ...$other_values): Redis|int|false;
/**
* Scan the members of a redis SET key.
*
* @see https://redis.io/commands/sscan
* @see https://redis.io/commands/scan
* @see Redis::setOption()
*
* @param string $key The Redis SET key in question.
* @param int $iterator A reference to an iterator which should be initialized to NULL that
* PhpRedis will update with the value returned from Redis after each
* subsequent call to SSCAN. Once this cursor is zero you know all
* members have been traversed.
* @param string|null $pattern An optional glob style pattern to match against, so Redis only
* returns the subset of members matching this pattern.
* @param int $count A hint to Redis as to how many members it should scan in one command
* before returning members for that iteration.
*
* @example
* $redis->del('myset');
* for ($i = 0; $i < 10000; $i++) {
* $redis->sAdd('myset', "member:$i");
* }
* $redis->sadd('myset', 'foofoo');
*
* $redis->setOption(Redis::OPT_SCAN, Redis::SCAN_NORETRY);
*
* $scanned = 0;
* $it = null;
*
* // Without Redis::SCAN_RETRY we may receive empty results and
* // a nonzero iterator.
* do {
* // Scan members containing '5'
* $members = $redis->sscan('myset', $it, '*5*');
* foreach ($members as $member) {
* echo "NORETRY: $member\n";
* $scanned++;
* }
* } while ($it != 0);
* echo "TOTAL: $scanned\n";
*
* $redis->setOption(Redis::OPT_SCAN, Redis::SCAN_RETRY);
*
* $scanned = 0;
* $it = null;
*
* // With Redis::SCAN_RETRY PhpRedis will never return an empty array
* // when the cursor is non-zero
* while (($members = $redis->sscan('myset', $it, '*5*'))) {
* foreach ($members as $member) {
* echo "RETRY: $member\n";
* $scanned++;
* }
* }
*/
public function sscan(string $key, null|int|string &$iterator, ?string $pattern = null, int $count = 0): array|false;
/**
* Subscribes the client to the specified shard channels.
*
* @param array $channels One or more channel names.
* @param callable $cb The callback PhpRedis will invoke when we receive a message
* from one of the subscribed channels.
*
* @return bool True on success, false on faiilure. Note that this command will block the
* client in a subscribe loop, waiting for messages to arrive.
*
* @see https://redis.io/commands/ssubscribe
*
* @example
* $redis = new Redis(['host' => 'localhost']);
*
* $redis->ssubscribe(['channel-1', 'channel-2'], function ($redis, $channel, $message) {
* echo "[$channel]: $message\n";
*
* // Unsubscribe from the message channel when we read 'quit'
* if ($message == 'quit') {
* echo "Unsubscribing from '$channel'\n";
* $redis->sunsubscribe([$channel]);
* }
* });
*
* // Once we read 'quit' from both channel-1 and channel-2 the subscribe loop will be
* // broken and this command will execute.
* echo "Subscribe loop ended\n";
*/
public function ssubscribe(array $channels, callable $cb): bool;
/**
* Retrieve the length of a Redis STRING key.
*
* @param string $key The key we want the length of.
*
* @return Redis|int|false The length of the string key if it exists, zero if it does not, and
* false on failure.
*
* @see https://redis.io/commands/strlen
*
* @example $redis->strlen('mykey');
*/
public function strlen(string $key): Redis|int|false;
/**
* Subscribe to one or more Redis pubsub channels.
*
* @param array $channels One or more channel names.
* @param callable $cb The callback PhpRedis will invoke when we receive a message
* from one of the subscribed channels.
*
* @return bool True on success, false on faiilure. Note that this command will block the
* client in a subscribe loop, waiting for messages to arrive.
*
* @see https://redis.io/commands/subscribe
*
* @example
* $redis = new Redis(['host' => 'localhost']);
*
* $redis->subscribe(['channel-1', 'channel-2'], function ($redis, $channel, $message) {
* echo "[$channel]: $message\n";
*
* // Unsubscribe from the message channel when we read 'quit'
* if ($message == 'quit') {
* echo "Unsubscribing from '$channel'\n";
* $redis->unsubscribe([$channel]);
* }
* });
*
* // Once we read 'quit' from both channel-1 and channel-2 the subscribe loop will be
* // broken and this command will execute.
* echo "Subscribe loop ended\n";
*/
public function subscribe(array $channels, callable $cb): bool;
/**
* Unsubscribes the client from the given shard channels,
* or from all of them if none is given.
*
* @param array $channels One or more channels to unsubscribe from.
* @return Redis|array|bool The array of unsubscribed channels.
*
* @see https://redis.io/commands/sunsubscribe
* @see Redis::ssubscribe()
*
* @example
* $redis->ssubscribe(['channel-1', 'channel-2'], function ($redis, $channel, $message) {
* if ($message == 'quit') {
* echo "$channel => 'quit' detected, unsubscribing!\n";
* $redis->sunsubscribe([$channel]);
* } else {
* echo "$channel => $message\n";
* }
* });
*
* echo "We've unsubscribed from both channels, exiting\n";
*/
public function sunsubscribe(array $channels): Redis|array|bool;
/**
* Atomically swap two Redis databases so that all of the keys in the source database will
* now be in the destination database and vice-versa.
*
* Note: This command simply swaps Redis' internal pointer to the database and is therefore
* very fast, regardless of the size of the underlying databases.
*
* @param int $src The source database number
* @param int $dst The destination database number
*
* @return Redis|bool Success if the databases could be swapped and false on failure.
*
* @see https://redis.io/commands/swapdb
* @see Redis::del()
*
* @example
* $redis->select(0);
* $redis->set('db0-key', 'db0-value');
* $redis->swapdb(0, 1);
* $redis->get('db0-key');
*/
public function swapdb(int $src, int $dst): Redis|bool;
/**
* Retrieve the server time from the connected Redis instance.
*
* @see https://redis.io/commands/time
*
* @return A two element array consisting of a Unix Timestamp and the number of microseconds
* elapsed since the second.
*
* @example $redis->time();
*/
public function time(): Redis|array;
/**
* Get the amount of time a Redis key has before it will expire, in seconds.
*
* @param string $key The Key we want the TTL for.
* @return Redis|int|false (a) The number of seconds until the key expires, or -1 if the key has
* no expiration, and -2 if the key does not exist. In the event of an
* error, this command will return false.
*
* @see https://redis.io/commands/ttl
*
* @example $redis->ttl('mykey');
*/
public function ttl(string $key): Redis|int|false;
/**
* Get the type of a given Redis key.
*
* @see https://redis.io/commands/type
*
* @param string $key The key to check
* @return Redis|int|false The Redis type constant or false on failure.
*
* The Redis class defines several type constants that correspond with Redis key types.
*
* Redis::REDIS_NOT_FOUND
* Redis::REDIS_STRING
* Redis::REDIS_SET
* Redis::REDIS_LIST
* Redis::REDIS_ZSET
* Redis::REDIS_HASH
* Redis::REDIS_STREAM
* Redis::REDIS_VECTORSET
*
* @example
* foreach ($redis->keys('*') as $key) {
* echo "$key => " . $redis->type($key) . "\n";
* }
*/
public function type(string $key): Redis|int|false;
/**
* Delete one or more keys from the Redis database. Unlike this operation, the actual
* deletion is asynchronous, meaning it is safe to delete large keys without fear of
* Redis blocking for a long period of time.
*
* @param array|string $key_or_keys Either an array with one or more keys or a string with
* the first key to delete.
* @param string $other_keys If the first argument passed to this method was a string
* you may pass any number of additional key names.
*
* @return Redis|int|false The number of keys deleted or false on failure.
*
* @see https://redis.io/commands/unlink
* @see https://redis.io/commands/del
* @see Redis::del()
*
* @example $redis->unlink('key1', 'key2', 'key3');
* @example $redis->unlink(['key1', 'key2', 'key3']);
*/
public function unlink(array|string $key, string ...$other_keys): Redis|int|false;
/**
* Unsubscribe from one or more subscribed channels.
*
* @param array $channels One or more channels to unsubscribe from.
* @return Redis|array|bool The array of unsubscribed channels.
*
* @see https://redis.io/commands/unsubscribe
* @see Redis::subscribe()
*
* @example
* $redis->subscribe(['channel-1', 'channel-2'], function ($redis, $channel, $message) {
* if ($message == 'quit') {
* echo "$channel => 'quit' detected, unsubscribing!\n";
* $redis->unsubscribe([$channel]);
* } else {
* echo "$channel => $message\n";
* }
* });
*
* echo "We've unsubscribed from both channels, exiting\n";
*/
public function unsubscribe(array $channels): Redis|array|bool;
/**
* Remove any previously WATCH'ed keys in a transaction.
*
* @see https://redis.io/commands/unwatch
* @see https://redis.io/commands/unwatch
* @see Redis::watch()
*
* @return True on success and false on failure.
*/
public function unwatch(): Redis|bool;
/**
* Watch one or more keys for conditional execution of a transaction.
*
* @param array|string $key_or_keys Either an array with one or more key names, or a string key name
* @param string $other_keys If the first argument was passed as a string, any number of additional
* string key names may be passed variadically.
* @return Redis|bool
*
*
* @see https://redis.io/commands/watch
* @see https://redis.io/commands/unwatch
*
* @example
* $redis1 = new Redis(['host' => 'localhost']);
* $redis2 = new Redis(['host' => 'localhost']);
*
* // Start watching 'incr-key'
* $redis1->watch('incr-key');
*
* // Retrieve its value.
* $val = $redis1->get('incr-key');
*
* // A second client modifies 'incr-key' after we read it.
* $redis2->set('incr-key', 0);
*
* // Because another client changed the value of 'incr-key' after we read it, this
* // is no longer a proper increment operation, but because we are `WATCH`ing the
* // key, this transaction will fail and we can try again.
* //
* // If were to comment out the above `$redis2->set('incr-key', 0)` line the
* // transaction would succeed.
* $redis1->multi();
* $redis1->set('incr-key', $val + 1);
* $res = $redis1->exec();
*
* // bool(false)
* var_dump($res);
*/
public function watch(array|string $key, string ...$other_keys): Redis|bool;
/**
* Block the client up to the provided timeout until a certain number of replicas have confirmed
* receiving them.
*
* @see https://redis.io/commands/wait
*
* @param int $numreplicas The number of replicas we want to confirm write operations
* @param int $timeout How long to wait (zero meaning forever).
*
* @return Redis|int|false The number of replicas that have confirmed or false on failure.
*
*/
public function wait(int $numreplicas, int $timeout): int|false;
/**
* Acknowledge one or more messages that are pending (have been consumed using XREADGROUP but
* not yet acknowledged by XACK.)
*
* @param string $key The stream to query.
* @param string $group The consumer group to use.
* @param array $ids An array of stream entry IDs.
*
* @return int|false The number of acknowledged messages
*
* @see https://redis.io/commands/xack
* @see https://redis.io/commands/xreadgroup
* @see Redis::xack()
*
* @example
* $redis->xAdd('ships', '*', ['name' => 'Enterprise']);
* $redis->xAdd('ships', '*', ['name' => 'Defiant']);
*
* $redis->xGroup('CREATE', 'ships', 'Federation', '0-0');
*
* // Consume a single message with the consumer group 'Federation'
* $ship = $redis->xReadGroup('Federation', 'Picard', ['ships' => '>'], 1);
*
* /* Retrieve the ID of the message we read.
* assert(isset($ship['ships']));
* $id = key($ship['ships']);
*
* // The message we just read is now pending.
* $res = $redis->xPending('ships', 'Federation'));
* var_dump($res);
*
* // We can tell Redis we were able to process the message by using XACK
* $res = $redis->xAck('ships', 'Federation', [$id]);
* assert($res === 1);
*
* // The message should no longer be pending.
* $res = $redis->xPending('ships', 'Federation');
* var_dump($res);
*/
public function xack(string $key, string $group, array $ids): int|false;
/**
* Append a message to a stream.
*
* @param string $key The stream name.
* @param string $id The ID for the message we want to add. This can be the special value '*'
* which means Redis will generate the ID that appends the message to the
* end of the stream. It can also be a value in the form <ms>-* which will
* generate an ID that appends to the end of entries with the same <ms> value
* (if any exist).
* @param int $maxlen If specified Redis will append the new message but trim any number of the
* oldest messages in the stream until the length is <= $maxlen.
* @param bool $approx Used in conjunction with `$maxlen`, this flag tells Redis to trim the stream
* but in a more efficient way, meaning the trimming may not be exactly to
* `$maxlen` values.
* @param bool $nomkstream If passed as `TRUE`, the stream must exist for Redis to append the message.
*
* @see https://redis.io/commands/xadd
*
* @example $redis->xAdd('ds9-season-1', '1-1', ['title' => 'Emissary Part 1']);
* @example $redis->xAdd('ds9-season-1', '1-2', ['title' => 'A Man Alone']);
*/
public function xadd(string $key, string $id, array $values, int $maxlen = 0, bool $approx = false, bool $nomkstream = false): Redis|string|false;
/**
* This command allows a consumer to claim pending messages that have been idle for a specified period of time.
* Its purpose is to provide a mechanism for picking up messages that may have had a failed consumer.
*
* @see https://redis.io/commands/xautoclaim
* @see https://redis.io/commands/xclaim
* @see https://redis.io/docs/data-types/streams-tutorial/
*
* @param string $key The stream to check.
* @param string $group The consumer group to query.
* @param string $consumer Which consumer to check.
* @param int $min_idle The minimum time in milliseconds for the message to have been pending.
* @param string $start The minimum message id to check.
* @param int $count An optional limit on how many messages are returned.
* @param bool $justid If the client only wants message IDs and not all of their data.
*
* @return Redis|array|bool An array of pending IDs or false if there are none, or on failure.
*
* @example
* $redis->xGroup('CREATE', 'ships', 'combatants', '0-0', true);
*
* $redis->xAdd('ships', '1424-74205', ['name' => 'Defiant']);
*
* // Consume the ['name' => 'Defiant'] message
* $msgs = $redis->xReadGroup('combatants', "Jem'Hadar", ['ships' => '>'], 1);
*
* // The "Jem'Hadar" consumer has the message presently
* $pending = $redis->xPending('ships', 'combatants');
* var_dump($pending);
*
* // Assume control of the pending message with a different consumer.
* $res = $redis->xAutoClaim('ships', 'combatants', 'Sisko', 0, '0-0');
*
* // Now the 'Sisko' consumer owns the message
* $pending = $redis->xPending('ships', 'combatants');
* var_dump($pending);
*/
public function xautoclaim(string $key, string $group, string $consumer, int $min_idle, string $start, int $count = -1, bool $justid = false): Redis|bool|array;
/**
* This method allows a consumer to take ownership of pending stream entries, by ID. Another
* command that does much the same thing but does not require passing specific IDs is `Redis::xAutoClaim`.
*
* @see https://redis.io/commands/xclaim
* @see https://redis.io/commands/xautoclaim.
*
* @param string $key The stream we wish to claim messages for.
* @param string $group Our consumer group.
* @param string $consumer Our consumer.
* @param int $min_idle_time The minimum idle-time in milliseconds a message must have for ownership to be transferred.
* @param array $options An options array that modifies how the command operates.
*
* <code>
* # Following is an options array describing every option you can pass. Note that
* # 'IDLE', and 'TIME' are mutually exclusive.
* $options = [
* 'IDLE' => 3 # Set the idle time of the message to a 3. By default
* # the idle time is set to zero.
* 'TIME' => 1000*time() # Same as IDLE except it takes a unix timestamp in
* # milliseconds.
* 'RETRYCOUNT' => 0 # Set the retry counter to zero. By default XCLAIM
* # doesn't modify the counter.
* 'FORCE' # Creates the pending message entry even if IDs are
* # not already
* # in the PEL with another client.
* 'JUSTID' # Return only an array of IDs rather than the messages
* # themselves.
* ];
* </code>
*
* @return Redis|array|bool An array of claimed messages or false on failure.
*
* @example
* $redis->xGroup('CREATE', 'ships', 'combatants', '0-0', true);
*
* $redis->xAdd('ships', '1424-74205', ['name' => 'Defiant']);
*
* // Consume the ['name' => 'Defiant'] message
* $msgs = $redis->xReadGroup('combatants', "Jem'Hadar", ['ships' => '>'], 1);
*
* // The "Jem'Hadar" consumer has the message presently
* $pending = $redis->xPending('ships', 'combatants');
* var_dump($pending);
*
* assert($pending && isset($pending[1]));
*
* // Claim the message by ID.
* $claimed = $redis->xClaim('ships', 'combatants', 'Sisko', 0, [$pending[1]], ['JUSTID']);
* var_dump($claimed);
*
* // Now the 'Sisko' consumer owns the message
* $pending = $redis->xPending('ships', 'combatants');
* var_dump($pending);
*/
public function xclaim(string $key, string $group, string $consumer, int $min_idle, array $ids, array $options): Redis|array|bool;
/**
* Remove one or more specific IDs from a stream.
*
* @param string $key The stream to modify.
* @param array $ids One or more message IDs to remove.
*
* @return Redis|int|false The number of messages removed or false on failure.
*
* @example $redis->xDel('stream', ['1-1', '2-1', '3-1']);
*/
public function xdel(string $key, array $ids): Redis|int|false;
/**
* XGROUP
*
* Perform various operation on consumer groups for a particular Redis STREAM. What the command does
* is primarily based on which operation is passed.
*
* @see https://redis.io/commands/xgroup/
*
* @param string $operation The subcommand you intend to execute. Valid options are as follows
* 'HELP' - Redis will return information about the command
* Requires: none
* 'CREATE' - Create a consumer group.
* Requires: Key, group, consumer.
* 'SETID' - Set the ID of an existing consumer group for the stream.
* Requires: Key, group, id.
* 'CREATECONSUMER' - Create a new consumer group for the stream. You must
* also pass key, group, and the consumer name you wish to
* create.
* Requires: Key, group, consumer.
* 'DELCONSUMER' - Delete a consumer from group attached to the stream.
* Requires: Key, group, consumer.
* 'DESTROY' - Delete a consumer group from a stream.
* Requires: Key, group.
* @param string $key The STREAM we're operating on.
* @param string $group The consumer group we want to create/modify/delete.
* @param string $id_or_consumer The STREAM id (e.g. '$') or consumer group. See the operation section
* for information about which to send.
* @param bool $mkstream This flag may be sent in combination with the 'CREATE' operation, and
* cause Redis to also create the STREAM if it doesn't currently exist.
*
* @param bool $entriesread Allows you to set Redis' 'entries-read' STREAM value. This argument is
* only relevant to the 'CREATE' and 'SETID' operations.
* Note: Requires Redis >= 7.0.0.
*
* @return mixed This command return various results depending on the operation performed.
*/
public function xgroup(string $operation, ?string $key = null, ?string $group = null, ?string $id_or_consumer = null,
bool $mkstream = false, int $entries_read = -2): mixed;
/**
* Retrieve information about a stream key.
*
* @param string $operation The specific info operation to perform.
* @param string $arg1 The first argument (depends on operation)
* @param string $arg2 The second argument
* @param int $count The COUNT argument to `XINFO STREAM`
*
* @return mixed This command can return different things depending on the operation being called.
*
* @see https://redis.io/commands/xinfo
*
* @example $redis->xInfo('CONSUMERS', 'stream');
* @example $redis->xInfo('GROUPS', 'stream');
* @example $redis->xInfo('STREAM', 'stream');
*/
public function xinfo(string $operation, ?string $arg1 = null, ?string $arg2 = null, int $count = -1): mixed;
/**
* Get the number of messages in a Redis STREAM key.
*
* @param string $key The Stream to check.
*
* @return Redis|int|false The number of messages or false on failure.
*
* @see https://redis.io/commands/xlen
*
* @example $redis->xLen('stream');
*/
public function xlen(string $key): Redis|int|false;
/**
* Interact with stream messages that have been consumed by a consumer group but not yet
* acknowledged with XACK.
*
* @see https://redis.io/commands/xpending
* @see https://redis.io/commands/xreadgroup
*
* @param string $key The stream to inspect.
* @param string $group The user group we want to see pending messages from.
* @param string $start The minimum ID to consider.
* @param string $string The maximum ID to consider.
* @param string $count Optional maximum number of messages to return.
* @param string $consumer If provided, limit the returned messages to a specific consumer.
*
* @return Redis|array|false The pending messages belonging to the stream or false on failure.
*
*/
public function xpending(string $key, string $group, ?string $start = null, ?string $end = null, int $count = -1, ?string $consumer = null): Redis|array|false;
/**
* Get a range of entries from a STREAM key.
*
* @param string $key The stream key name to list.
* @param string $start The minimum ID to return.
* @param string $end The maximum ID to return.
* @param int $count An optional maximum number of entries to return.
*
* @return Redis|array|bool The entries in the stream within the requested range or false on failure.
*
* @see https://redis.io/commands/xrange
*
* @example $redis->xRange('stream', '0-1', '0-2');
* @example $redis->xRange('stream', '-', '+');
*/
public function xrange(string $key, string $start, string $end, int $count = -1): Redis|array|bool;
/**
* Consume one or more unconsumed elements in one or more streams.
*
* @param array $streams An associative array with stream name keys and minimum id values.
* @param int $count An optional limit to how many entries are returned *per stream*
* @param int $block An optional maximum number of milliseconds to block the caller if no
* data is available on any of the provided streams.
*
* @return Redis|array|bool An array of read elements or false if there aren't any.
*
* @see https://redis.io/commands/xread
*
* @example
* $redis->xAdd('s03', '3-1', ['title' => 'The Search, Part I']);
* $redis->xAdd('s03', '3-2', ['title' => 'The Search, Part II']);
* $redis->xAdd('s03', '3-3', ['title' => 'The House Of Quark']);
* $redis->xAdd('s04', '4-1', ['title' => 'The Way of the Warrior']);
* $redis->xAdd('s04', '4-3', ['title' => 'The Visitor']);
* $redis->xAdd('s04', '4-4', ['title' => 'Hippocratic Oath']);
*
* $redis->xRead(['s03' => '3-2', 's04' => '4-1']);
*/
public function xread(array $streams, int $count = -1, int $block = -1): Redis|array|bool;
/**
* Read one or more messages using a consumer group.
*
* @param string $group The consumer group to use.
* @param string $consumer The consumer to use.
* @param array $streams An array of stream names and message IDs
* @param int $count Optional maximum number of messages to return
* @param int $block How long to block if there are no messages available.
*
* @return Redis|array|bool Zero or more unread messages or false on failure.
*
* @see https://redis.io/commands/xreadgroup
*
* @example
* $redis->xGroup('CREATE', 'episodes', 'ds9', '0-0', true);
*
* $redis->xAdd('episodes', '1-1', ['title' => 'Emissary: Part 1']);
* $redis->xAdd('episodes', '1-2', ['title' => 'A Man Alone']);
*
* $messages = $redis->xReadGroup('ds9', 'sisko', ['episodes' => '>']);
*
* // After having read the two messages, add another
* $redis->xAdd('episodes', '1-3', ['title' => 'Emissary: Part 2']);
*
* // Acknowledge the first two read messages
* foreach ($messages as $stream => $stream_messages) {
* $ids = array_keys($stream_messages);
* $redis->xAck('stream', 'ds9', $ids);
* }
*
* // We can now pick up where we left off, and will only get the final message
* $msgs = $redis->xReadGroup('ds9', 'sisko', ['episodes' => '>']);
*/
public function xreadgroup(string $group, string $consumer, array $streams, int $count = 1, int $block = 1): Redis|array|bool;
/**
* Get a range of entries from a STREAM key in reverse chronological order.
*
* @param string $key The stream key to query.
* @param string $end The maximum message ID to include.
* @param string $start The minimum message ID to include.
* @param int $count An optional maximum number of messages to include.
*
* @return Redis|array|bool The entries within the requested range, from newest to oldest.
*
* @see https://redis.io/commands/xrevrange
* @see https://redis.io/commands/xrange
*
* @example $redis->xRevRange('stream', '0-2', '0-1');
* @example $redis->xRevRange('stream', '+', '-');
*/
public function xrevrange(string $key, string $end, string $start, int $count = -1): Redis|array|bool;
/**
* Add to a vector set
*
* @param string $key The vector set to add to.
* @param array $values A non-empty array of floating point values
* @param mixed $element The element to add to the vector set.
* @param array|null $options An optional options array
*
* @return Redis|int|false One if the key was added zero if not.
*/
public function vadd(string $key, array $values, mixed $element, array|null $options = null): Redis|int|false;
/**
* Query similarity of a vector by element or scores
*
* @param string $key The vector set to query.
* @param mixed $member Either an element or array of scores. PhpRedis
* will attempt to infer which it is, but since
* there can be some ambiguity here due to
* serialization you can also explicitly specify
* `ELE`, `VALUES`, or `FP32` in the options
* array.
* @param array|null $options An optional options array
*
* @return Redis|array|false An array of elements and their similarity scores, or false on failure.
*/
public function vsim(string $key, mixed $member, array|null $options = null): Redis|array|false;
/**
* Get the length of a vector set
*
* @param string $key The vector set to query.
*
* @return Redis|int|false The number of elements in the vector set or false on failure.
*/
public function vcard(string $key): Redis|int|false;
/**
* Get the dimensions of a vector set
*
* @param string $key The vector set to query.
*
* @return Redis|int|false The number of dimensions in the vector set or false on failure.
*/
public function vdim(string $key): Redis|int|false;
/**
* Get various bits of information about a vector set
*
* @param string $key The vector set to query.
*
* @return Redis|array|false An array of information about the vector set or false on failure.
*/
public function vinfo(string $key): Redis|array|false;
/**
* Check if an element is a member of a vectorset
*
* @param string $key The vector set to query.
* @param mixed $member The member to check for.
*
* @return Redis|bool true if the member exists, false if it does not.
*/
public function vismember(string $key, mixed $member): Redis|bool;
/**
* Get the embeddings for a specific member
*
* @param string $key The vector set to query.
* @param mixed $member The member to query.
* @param bool $raw If set to `true`, the raw embeddings will be returned
*
* @return Redis|array|false An array of embeddings for the member or false on failure.
*/
public function vemb(string $key, mixed $member, bool $raw = false): Redis|array|false;
/**
* Get one or more random members from a vector set
*
* @param string $key The vector set to query.
* @param int $count The number of random members to return.
*/
public function vrandmember(string $key, int $count = 0): Redis|array|string|false;
/**
* Retreive a lexographical range of elements from a vector set
*
* @param string $key The vector set to query.
* @param string $min The minimum element to return.
* @param string $max The maximum element to return.
* @param int $count An optional maximum number of elements to return.
*
* @return Redis|array|false An array of elements in the requested range or false on failure.
*/
public function vrange(string $key, string $min, string $max, int $count = -1): Redis|array|false;
/**
* Remove an element from a vector set
*
* @param string $key The vector set to remove from.
* @param mixed $member The member to remove.
*
* @return Redis|int|faslse 1 if the member was removed, 0 if it was not.
*/
public function vrem(string $key, mixed $member): Redis|int|false;
/**
* Set the attributes of a vector set element
*
* @param string $key The vector set to modify.
* @param mixed $member The member to modify.
* @param array|string $attributes The attributes to set. This should either
* be a json encoded string or an array which
* will be json encoded.
*
* @return Redis|int|false 1 if the attributes were set, 0 if they were not.
*/
public function vsetattr(string $key, mixed $member, array|string $attributes): Redis|int|false;
/**
* Get the attributes of a vector set element
*
* @param string $key The vector set to query.
* @param mixed $member The member to query.
* @param bool $decode Whether to automatically deserialize any returned json.
*
* @return Redis|array|false An array of attributes for the member or false on failure.
*/
public function vgetattr(string $key, mixed $member, bool $decode = true): Redis|array|string|false;
/**
* Get any adajcent values for a member of a vector set.
*
* @param string $key The vector set to query.
* @param mixed $member The member to query.
* @param bool $withscores If set to `true`, the scores of the adjacent values will be returned.
*
* @return Redis|array|false An array of adjacent values and their scores, or false on failure.
*/
public function vlinks(string $key, mixed $member, bool $withscores = false): Redis|array|false;
/**
* Truncate a STREAM key in various ways.
*
* @param string $key The STREAM key to trim.
* @param string $threshold This can either be a maximum length, or a minimum id.
* MAXLEN - An integer describing the maximum desired length of the stream after the command.
* MINID - An ID that will become the new minimum ID in the stream, as Redis will trim all
* messages older than this ID.
* @param bool $approx Whether redis is allowed to do an approximate trimming of the stream. This is
* more efficient for Redis given how streams are stored internally.
* @param bool $minid When set to `true`, users should pass a minimum ID to the `$threshold` argument.
* @param int $limit An optional upper bound on how many entries to trim during the command.
*
* @return Redis|int|false The number of entries deleted from the stream.
*
* @see https://redis.io/commands/xtrim
*
* @example $redis->xTrim('stream', 3);
* @example $redis->xTrim('stream', '2-1', false, true);
*/
public function xtrim(string $key, string $threshold, bool $approx = false, bool $minid = false, int $limit = -1): Redis|int|false;
/**
* Add one or more elements and scores to a Redis sorted set.
*
* @param string $key The sorted set in question.
* @param array|float $score_or_options Either the score for the first element, or an array of options.
* <code>
* $options = [
* 'NX', # Only update elements that already exist
* 'NX', # Only add new elements but don't update existing ones.
*
* 'LT' # Only update existing elements if the new score is
* # less than the existing one.
* 'GT' # Only update existing elements if the new score is
* # greater than the existing one.
*
* 'CH' # Instead of returning the number of elements added,
* # Redis will return the number Of elements that were
* # changed in the operation.
*
* 'INCR' # Instead of setting each element to the provide score,
* # increment the element by the
* # provided score, much like ZINCRBY. When this option
* # is passed, you may only send a single score and member.
* ];
*
* Note: 'GX', 'LT', and 'NX' cannot be passed together, and PhpRedis
* will send whichever one is last in the options array.
*
* @param mixed $more_scores_and_mems A variadic number of additional scores and members.
*
* @return Redis|int|false The return value varies depending on the options passed.
*
* Following is information about the options that may be passed as the second argument:
*
* @see https://redis.io/commands/zadd
*
* @example $redis->zadd('zs', 1, 'first', 2, 'second', 3, 'third');
* @example $redis->zAdd('zs', ['XX'], 8, 'second', 99, 'new-element');
*/
public function zAdd(string $key, array|float $score_or_options, mixed ...$more_scores_and_mems): Redis|int|float|false;
/**
* Return the number of elements in a sorted set.
*
* @param string $key The sorted set to retrieve cardinality from.
*
* @return Redis|int|false The number of elements in the set or false on failure
*
* @see https://redis.io/commands/zcard
*
* @example $redis->zCard('zs');
*/
public function zCard(string $key): Redis|int|false;
/**
* Count the number of members in a sorted set with scores inside a provided range.
*
* @param string $key The sorted set to check.
* @param int|string $min The minimum score to include in the count
* @param int|string $max The maximum score to include in the count
*
* NOTE: In addition to a floating point score you may pass the special values of '-inf' and
* '+inf' meaning negative and positive infinity, respectively.
*
* @see https://redis.io/commands/zcount
*
* @example $redis->zCount('fruit-rankings', '0', '+inf');
* @example $redis->zCount('fruit-rankings', 50, 60);
* @example $redis->zCount('fruit-rankings', '-inf', 0);
*/
public function zCount(string $key, int|string $start, int|string $end): Redis|int|false;
/**
* Create or increment the score of a member in a Redis sorted set
*
* @param string $key The sorted set in question.
* @param float $value How much to increment the score.
*
* @return Redis|float|false The new score of the member or false on failure.
*
* @see https://redis.io/commands/zincrby
*
* @example $redis->zIncrBy('zs', 5.0, 'bananas');
* @example $redis->zIncrBy('zs', 2.0, 'eggplants');
*/
public function zIncrBy(string $key, float $value, mixed $member): Redis|float|false;
/**
* Count the number of elements in a sorted set whose members fall within the provided
* lexographical range.
*
* @param string $key The sorted set to check.
* @param string $min The minimum matching lexographical string
* @param string $max The maximum matching lexographical string
*
* @return Redis|int|false The number of members that fall within the range or false on failure.
*
* @see https://redis.io/commands/zlexcount
*
* @example
* $redis->zAdd('captains', 0, 'Janeway', 0, 'Kirk', 0, 'Picard', 0, 'Sisko', 0, 'Archer');
* $redis->zLexCount('captains', '[A', '[S');
*/
public function zLexCount(string $key, string $min, string $max): Redis|int|false;
/**
* Retrieve the score of one or more members in a sorted set.
*
* @see https://redis.io/commands/zmscore
*
* @param string $key The sorted set
* @param mixed $member The first member to return the score from
* @param mixed $other_members One or more additional members to return the scores of.
*
* @return Redis|array|false An array of the scores of the requested elements.
*
* @example
* $redis->zAdd('zs', 0, 'zero', 1, 'one', 2, 'two', 3, 'three');
*
* $redis->zMScore('zs', 'zero', 'two');
* $redis->zMScore('zs', 'one', 'not-a-member');
*/
public function zMscore(string $key, mixed $member, mixed ...$other_members): Redis|array|false;
/**
* Pop one or more of the highest scoring elements from a sorted set.
*
* @param string $key The sorted set to pop elements from.
* @param int $count An optional count of elements to pop.
*
* @return Redis|array|false All of the popped elements with scores or false on failure
*
* @see https://redis.io/commands/zpopmax
*
* @example
* $redis->zAdd('zs', 0, 'zero', 1, 'one', 2, 'two', 3, 'three');
*
* $redis->zPopMax('zs');
* $redis->zPopMax('zs', 2);.
*/
public function zPopMax(string $key, ?int $count = null): Redis|array|false;
/**
* Pop one or more of the lowest scoring elements from a sorted set.
*
* @param string $key The sorted set to pop elements from.
* @param int $count An optional count of elements to pop.
*
* @return Redis|array|false The popped elements with their scores or false on failure.
*
* @see https://redis.io/commands/zpopmin
*
* @example
* $redis->zAdd('zs', 0, 'zero', 1, 'one', 2, 'two', 3, 'three');
*
* $redis->zPopMin('zs');
* $redis->zPopMin('zs', 2);
*/
public function zPopMin(string $key, ?int $count = null): Redis|array|false;
/**
* Retrieve a range of elements of a sorted set between a start and end point.
* How the command works in particular is greatly affected by the options that
* are passed in.
*
* @param string $key The sorted set in question.
* @param mixed $start The starting index we want to return.
* @param mixed $end The final index we want to return.
*
* @param array|bool|null $options This value may either be an array of options to pass to
* the command, or for historical purposes a boolean which
* controls just the 'WITHSCORES' option.
* <code>
* $options = [
* 'WITHSCORES' => true, # Return both scores and members.
* 'LIMIT' => [10, 10], # Start at offset 10 and return 10 elements.
* 'REV' # Return the elements in reverse order
* 'BYSCORE', # Treat `start` and `end` as scores instead
* 'BYLEX' # Treat `start` and `end` as lexicographical values.
* ];
* </code>
*
* Note: 'BYLEX' and 'BYSCORE' are mutually exclusive.
*
*
* @return Redis|array|false An array with matching elements or false on failure.
*
* @see https://redis.io/commands/zrange/
* @category zset
*
* @example $redis->zRange('zset', 0, -1);
* @example $redis->zRange('zset', '-inf', 'inf', ['byscore']);
*/
public function zRange(string $key, string|int $start, string|int $end, array|bool|null $options = null): Redis|array|false;
/**
* Retrieve a range of elements from a sorted set by legographical range.
*
* @param string $key The sorted set to retrieve elements from
* @param string $min The minimum legographical value to return
* @param string $max The maximum legographical value to return
* @param int $offset An optional offset within the matching values to return
* @param int $count An optional count to limit the replies to (used in conjunction with offset)
*
* @return Redis|array|false An array of matching elements or false on failure.
*
* @see https://redis.io/commands/zrangebylex
*
* @example
* $redis = new Redis(['host' => 'localhost']);
* $redis->zAdd('captains', 0, 'Janeway', 0, 'Kirk', 0, 'Picard', 0, 'Sisko', 0, 'Archer');
*
* $redis->zRangeByLex('captains', '[A', '[S');
* $redis->zRangeByLex('captains', '[A', '[S', 2, 2);
*/
public function zRangeByLex(string $key, string $min, string $max, int $offset = -1, int $count = -1): Redis|array|false;
/**
* Retrieve a range of members from a sorted set by their score.
*
* @param string $key The sorted set to query.
* @param string $start The minimum score of elements that Redis should return.
* @param string $end The maximum score of elements that Redis should return.
* @param array $options Options that change how Redis will execute the command.
*
* OPTION TYPE MEANING
* 'WITHSCORES' bool Whether to also return scores.
* 'LIMIT' [offset, count] Limit the reply to a subset of elements.
*
* @return Redis|array|false The number of matching elements or false on failure.
*
* @see https://redis.io/commands/zrangebyscore
*
* @example $redis->zRangeByScore('zs', 20, 30, ['WITHSCORES' => true]);
* @example $redis->zRangeByScore('zs', 20, 30, ['WITHSCORES' => true, 'LIMIT' => [5, 5]]);
*/
public function zRangeByScore(string $key, string $start, string $end, array $options = []): Redis|array|false;
/**
* This command is similar to ZRANGE except that instead of returning the values directly
* it will store them in a destination key provided by the user
*
* @param string $dstkey The key to store the resulting element(s)
* @param string $srckey The source key with element(s) to retrieve
* @param string $start The starting index to store
* @param string $end The ending index to store
* @param array|bool|null $options Our options array that controls how the command will function.
*
* @return Redis|int|false The number of elements stored in $dstkey or false on failure.
*
* @see https://redis.io/commands/zrange/
* @see Redis::zRange
* @category zset
*
* See {@link Redis::zRange} for a full description of the possible options.
*/
public function zrangestore(string $dstkey, string $srckey, string $start, string $end,
array|bool|null $options = null): Redis|int|false;
/**
* Retrieve one or more random members from a Redis sorted set.
*
* @param string $key The sorted set to pull random members from.
* @param array $options One or more options that determine exactly how the command operates.
*
* OPTION TYPE MEANING
* 'COUNT' int The number of random members to return.
* 'WITHSCORES' bool Whether to return scores and members instead of
*
* @return Redis|string|array One or more random elements.
*
* @see https://redis.io/commands/zrandmember
*
* @example $redis->zRandMember('zs', ['COUNT' => 2, 'WITHSCORES' => true]);
*/
public function zRandMember(string $key, ?array $options = null): Redis|string|array;
/**
* Get the rank of a member of a sorted set, by score.
*
* @param string $key The sorted set to check.
* @param mixed $member The member to test.
*
* @return Redis|int|false The rank of the requested member.
* @see https://redis.io/commands/zrank
*
* @example $redis->zRank('zs', 'zero');
* @example $redis->zRank('zs', 'three');
*/
public function zRank(string $key, mixed $member): Redis|int|false;
/**
* Remove one or more members from a Redis sorted set.
*
* @param mixed $key The sorted set in question.
* @param mixed $member The first member to remove.
* @param mixed $other_members One or more members to remove passed in a variadic fashion.
*
* @return Redis|int|false The number of members that were actually removed or false on failure.
*
* @see https://redis.io/commands/zrem
*
* @example $redis->zRem('zs', 'mem:0', 'mem:1', 'mem:2', 'mem:6', 'mem:7', 'mem:8', 'mem:9');
*/
public function zRem(mixed $key, mixed $member, mixed ...$other_members): Redis|int|false;
/**
* Remove zero or more elements from a Redis sorted set by legographical range.
*
* @param string $key The sorted set to remove elements from.
* @param string $min The start of the lexographical range to remove.
* @param string $max The end of the lexographical range to remove
*
* @return Redis|int|false The number of elements removed from the set or false on failure.
*
* @see https://redis.io/commands/zremrangebylex
* @see Redis::zrangebylex()
*
* @example $redis->zRemRangeByLex('zs', '[a', '(b');
* @example $redis->zRemRangeByLex('zs', '(banana', '(eggplant');
*/
public function zRemRangeByLex(string $key, string $min, string $max): Redis|int|false;
/**
* Remove one or more members of a sorted set by their rank.
*
* @param string $key The sorted set where we want to remove members.
* @param int $start The rank when we want to start removing members
* @param int $end The rank we want to stop removing membersk.
*
* @return Redis|int|false The number of members removed from the set or false on failure.
*
* @see https://redis.io/commands/zremrangebyrank
*
* @example $redis->zRemRangeByRank('zs', 0, 3);
*/
public function zRemRangeByRank(string $key, int $start, int $end): Redis|int|false;
/**
* Remove one or more members of a sorted set by their score.
*
* @param string $key The sorted set where we want to remove members.
* @param int $start The lowest score to remove.
* @param int $end The highest score to remove.
*
* @return Redis|int|false The number of members removed from the set or false on failure.
*
* @see https://redis.io/commands/zremrangebyrank
*
* @example
* $redis->zAdd('zs', 2, 'two', 4, 'four', 6, 'six');
* $redis->zRemRangeByScore('zs', 2, 4);
*/
public function zRemRangeByScore(string $key, string $start, string $end): Redis|int|false;
/**
* List the members of a Redis sorted set in reverse order
*
* @param string $key The sorted set in question.
* @param int $start The index to start listing elements
* @param int $end The index to stop listing elements.
* @param mixed $withscores Whether or not Redis should also return each members score. See
* the example below demonstrating how it may be used.
*
* @return Redis|array|false The members (and possibly scores) of the matching elements or false
* on failure.
*
* @see https://redis.io/commands/zrevrange
*
* @example $redis->zRevRange('zs', 0, -1);
* @example $redis->zRevRange('zs', 2, 3);
* @example $redis->zRevRange('zs', 0, -1, true);
* @example $redis->zRevRange('zs', 0, -1, ['withscores' => true]);
*/
public function zRevRange(string $key, int $start, int $end, mixed $scores = null): Redis|array|false;
/**
* List members of a Redis sorted set within a legographical range, in reverse order.
*
* @param string $key The sorted set to list
* @param string $min The maximum legographical element to include in the result.
* @param string $min The minimum lexographical element to include in the result.
* @param string $offset An option offset within the matching elements to start at.
* @param string $count An optional count to limit the replies to.
*
* @return Redis|array|false The matching members or false on failure.
*
* @see https://redis.io/commands/zrevrangebylex
* @see Redis::zrangebylex()
*
* @example $redis->zRevRangeByLex('captains', '[Q', '[J');
* @example $redis->zRevRangeByLex('captains', '[Q', '[J', 1, 2);
*/
public function zRevRangeByLex(string $key, string $max, string $min, int $offset = -1, int $count = -1): Redis|array|false;
/**
* List elements from a Redis sorted set by score, highest to lowest
*
* @param string $key The sorted set to query.
* @param string $max The highest score to include in the results.
* @param string $min The lowest score to include in the results.
* @param array $options An options array that modifies how the command executes.
*
* <code>
* $options = [
* 'WITHSCORES' => true|false # Whether or not to return scores
* 'LIMIT' => [offset, count] # Return a subset of the matching members
* ];
* </code>
*
* NOTE: For legacy reason, you may also simply pass `true` for the
* options argument, to mean `WITHSCORES`.
*
* @return Redis|array|false The matching members in reverse order of score or false on failure.
*
* @see https://redis.io/commands/zrevrangebyscore
*
* @example
* $redis->zadd('oldest-people', 122.4493, 'Jeanne Calment', 119.2932, 'Kane Tanaka',
* 119.2658, 'Sarah Knauss', 118.7205, 'Lucile Randon',
* 117.7123, 'Nabi Tajima', 117.6301, 'Marie-Louise Meilleur',
* 117.5178, 'Violet Brown', 117.3753, 'Emma Morano',
* 117.2219, 'Chiyo Miyako', 117.0740, 'Misao Okawa');
*
* $redis->zRevRangeByScore('oldest-people', 122, 119);
* $redis->zRevRangeByScore('oldest-people', 'inf', 118);
* $redis->zRevRangeByScore('oldest-people', '117.5', '-inf', ['LIMIT' => [0, 1]]);
*/
public function zRevRangeByScore(string $key, string $max, string $min, array|bool $options = []): Redis|array|false;
/**
* Retrieve a member of a sorted set by reverse rank.
*
* @param string $key The sorted set to query.
* @param mixed $member The member to look up.
*
* @return Redis|int|false The reverse rank (the rank if counted high to low) of the member or
* false on failure.
* @see https://redis.io/commands/zrevrank
*
* @example
* $redis->zAdd('ds9-characters', 10, 'Sisko', 9, 'Garak', 8, 'Dax', 7, 'Odo');
*
* $redis->zrevrank('ds9-characters', 'Sisko');
* $redis->zrevrank('ds9-characters', 'Garak');
*/
public function zRevRank(string $key, mixed $member): Redis|int|false;
/**
* Get the score of a member of a sorted set.
*
* @param string $key The sorted set to query.
* @param mixed $member The member we wish to query.
*
* @return The score of the requested element or false if it is not found.
*
* @see https://redis.io/commands/zscore
*
* @example
* $redis->zAdd('telescopes', 11.9, 'LBT', 10.4, 'GTC', 10, 'HET');
* $redis->zScore('telescopes', 'LBT');
*/
public function zScore(string $key, mixed $member): Redis|float|false;
/**
* Given one or more sorted set key names, return every element that is in the first
* set but not any of the others.
*
* @param array $keys One or more sorted sets.
* @param array $options An array which can contain ['WITHSCORES' => true] if you want Redis to
* return members and scores.
*
* @return Redis|array|false An array of members or false on failure.
*
* @see https://redis.io/commands/zdiff
*
* @example
* $redis->zAdd('primes', 1, 'one', 3, 'three', 5, 'five');
* $redis->zAdd('evens', 2, 'two', 4, 'four');
* $redis->zAdd('mod3', 3, 'three', 6, 'six');
*
* $redis->zDiff(['primes', 'evens', 'mod3']);
*/
public function zdiff(array $keys, ?array $options = null): Redis|array|false;
/**
* Store the difference of one or more sorted sets in a destination sorted set.
*
* See {@link Redis::zdiff} for a more detailed description of how the diff operation works.
*
* @param string $key The destination set name.
* @param array $keys One or more source key names
*
* @return Redis|int|false The number of elements stored in the destination set or false on
* failure.
*
* @see https://redis.io/commands/zdiff
* @see Redis::zdiff()
*/
public function zdiffstore(string $dst, array $keys): Redis|int|false;
/**
* Compute the intersection of one or more sorted sets and return the members
*
* @param array $keys One or more sorted sets.
* @param array $weights An optional array of weights to be applied to each set when performing
* the intersection.
* @param array $options Options for how Redis should combine duplicate elements when performing the
* intersection. See Redis::zunion() for details.
*
* @return Redis|array|false All of the members that exist in every set.
*
* @see https://redis.io/commands/zinter
*
* @example
* $redis->zAdd('TNG', 2, 'Worf', 2.5, 'Data', 4.0, 'Picard');
* $redis->zAdd('DS9', 2.5, 'Worf', 3.0, 'Kira', 4.0, 'Sisko');
*
* $redis->zInter(['TNG', 'DS9']);
* $redis->zInter(['TNG', 'DS9'], NULL, ['withscores' => true]);
* $redis->zInter(['TNG', 'DS9'], NULL, ['withscores' => true, 'aggregate' => 'max']);
*/
public function zinter(array $keys, ?array $weights = null, ?array $options = null): Redis|array|false;
/**
* Similar to ZINTER but instead of returning the intersected values, this command returns the
* cardinality of the intersected set.
*
* @see https://redis.io/commands/zintercard
* @see https://redis.io/commands/zinter
* @see Redis::zinter()
*
* @param array $keys One or more sorted set key names.
* @param int $limit An optional upper bound on the returned cardinality. If set to a value
* greater than zero, Redis will stop processing the intersection once the
* resulting cardinality reaches this limit.
*
* @return Redis|int|false The cardinality of the intersection or false on failure.
*
* @example
* $redis->zAdd('zs1', 1, 'one', 2, 'two', 3, 'three', 4, 'four');
* $redis->zAdd('zs2', 2, 'two', 4, 'four');
*
* $redis->zInterCard(['zs1', 'zs2']);
*/
public function zintercard(array $keys, int $limit = -1): Redis|int|false;
/**
* Compute the intersection of one or more sorted sets storing the result in a new sorted set.
*
* @param string $dst The destination sorted set to store the intersected values.
* @param array $keys One or more sorted set key names.
* @param array $weights An optional array of floats to weight each passed input set.
* @param string $aggregate An optional aggregation method to use.
*
* 'SUM' - Store sum of all intersected members (this is the default).
* 'MIN' - Store minimum value for each intersected member.
* 'MAX' - Store maximum value for each intersected member.
*
* @return Redis|int|false The total number of members writtern to the destination set or false on failure.
*
* @see https://redis.io/commands/zinterstore
* @see https://redis.io/commands/zinter
*
* @example
* $redis->zAdd('zs1', 3, 'apples', 2, 'pears');
* $redis->zAdd('zs2', 4, 'pears', 3, 'bananas');
* $redis->zAdd('zs3', 2, 'figs', 3, 'pears');
*
* $redis->zInterStore('fruit-sum', ['zs1', 'zs2', 'zs3']);
* $redis->zInterStore('fruit-max', ['zs1', 'zs2', 'zs3'], NULL, 'MAX');
*/
public function zinterstore(string $dst, array $keys, ?array $weights = null, ?string $aggregate = null): Redis|int|false;
/**
* Scan the members of a sorted set incrementally, using a cursor
*
* @param string $key The sorted set to scan.
* @param int $iterator A reference to an iterator that should be initialized to NULL initially, that
* will be updated after each subsequent call to ZSCAN. Once the iterator
* has returned to zero the scan is complete
* @param string|null $pattern An optional glob-style pattern that limits which members are returned during
* the scanning process.
* @param int $count A hint for Redis that tells it how many elements it should test before returning
* from the call. The higher the more work Redis may do in any one given call to
* ZSCAN potentially blocking for longer periods of time.
*
* @return Redis|array|false An array of elements or false on failure.
*
* @see https://redis.io/commands/zscan
* @see https://redis.io/commands/scan
* @see Redis::scan()
*
* NOTE: See Redis::scan() for detailed example code on how to call SCAN like commands.
*
*/
public function zscan(string $key, null|int|string &$iterator, ?string $pattern = null, int $count = 0): Redis|array|false;
/**
* Retrieve the union of one or more sorted sets
*
* @param array $keys One or more sorted set key names
* @param array $weights An optional array with floating point weights used when performing the union.
* Note that if this argument is passed, it must contain the same number of
* elements as the $keys array.
* @param array $options An array that modifies how this command functions.
*
* <code>
* $options = [
* # By default when members exist in more than one set Redis will SUM
* # total score for each match. Instead, it can return the AVG, MIN,
* # or MAX value based on this option.
* 'AGGREGATE' => 'sum' | 'min' | 'max'
*
* # Whether Redis should also return each members aggregated score.
* 'WITHSCORES' => true | false
* ]
* </code>
*
* @return Redis|array|false The union of each sorted set or false on failure
*
* @example
* $redis->del('store1', 'store2', 'store3');
* $redis->zAdd('store1', 1, 'apples', 3, 'pears', 6, 'bananas');
* $redis->zAdd('store2', 3, 'apples', 5, 'coconuts', 2, 'bananas');
* $redis->zAdd('store3', 2, 'bananas', 6, 'apples', 4, 'figs');
*
* $redis->zUnion(['store1', 'store2', 'store3'], NULL, ['withscores' => true]);
* $redis->zUnion(['store1', 'store3'], [2, .5], ['withscores' => true]);
* $redis->zUnion(['store1', 'store3'], [2, .5], ['withscores' => true, 'aggregate' => 'MIN']);
*/
public function zunion(array $keys, ?array $weights = null, ?array $options = null): Redis|array|false;
/**
* Perform a union on one or more Redis sets and store the result in a destination sorted set.
*
* @param string $dst The destination set to store the union.
* @param array $keys One or more input keys on which to perform our union.
* @param array $weights An optional weights array used to weight each input set.
* @param string $aggregate An optional modifier in how Redis will combine duplicate members.
* Valid: 'MIN', 'MAX', 'SUM'.
*
* @return Redis|int|false The number of members stored in the destination set or false on failure.
*
* @see https://redis.io/commands/zunionstore
* @see Redis::zunion()
*
* @example
* $redis->zAdd('zs1', 1, 'one', 3, 'three');
* $redis->zAdd('zs1', 2, 'two', 4, 'four');
* $redis->zadd('zs3', 1, 'one', 7, 'five');
*
* $redis->zUnionStore('dst', ['zs1', 'zs2', 'zs3']);
*/
public function zunionstore(string $dst, array $keys, ?array $weights = null, ?string $aggregate = null): Redis|int|false;
}
class RedisException extends RuntimeException {}